Looking up objects in Pastry

Size: px
Start display at page:

Download "Looking up objects in Pastry"

Transcription

1 Review: Pstry routing tbles b c d e f b c d e f b c d e f b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech prefi p of i, nd ech digit d [0 f], hs contct with ID prefi pd

2 Looking up objects in Pstry d471f1 d41c d47c4 d42b d4213f d13d3 1fc locte(d41c) Corrects one digit t time - Queries nodes with IDs: d13d3, d4213f, d42b - Then use lef set to find node with nerest ID to trget

3 Joining the system Must know of one eisting node in system - Query it nd other nodes to find node closest to your ID d471f1 d41c d47c4 d42b ddnode(d41c) d4213f d13d3 1fc Initilize lef tble from node closes to ID - Will know lmost complete lef set for new node

4 Initilizing routing tble Cn t initilize routing tble from closest node - Eg, 1fffff s closest node might be y But cn fill up routing tble from intermedite nodes - Cn use entire first row of first node contcted - Use second row of second node contcted, since sme first digit s joining node Once join procedure complete, cn issue queries - New node knows enough to route to nd ID But wht bout queries to IDs ner new node?

5 Fiing up stte for join New node must fi other nodes routing tbles s well s initilize its own For correctness, need to fi up neighbor s lef sets - Esy, node cn contct them fter initilizing its own lef set - If lef sets correct, routing works, but could tke O(N) hops Updting other nodes routing tbles: - Old routing tbles either correct, or missing entry new node could fill - Automticlly fill holes s side ffect of lookups - New node sends its stte to ech node in its routing tble - Nodes periodiclly query to try to fill holes in their tbles

6 Node filure Nodes cn fil without wrning - Other node s routing tbles & lefs sets point to ded node Routing tble: Detect timeout, tret s empty slot - Route to numericlly closest vilble - Repir: Ask ny node on sme row for its contct Or sk ny node below, since ll will hve correct prefi Lef sets: Node closest to trget could be ded - Need to find net closest - Tht s why lef sets not just one neighbor (O(log N)) - Esy to updte lef sets by contcting other nerby nodes

7 How relible is Pstry? For correctness, only need lef sets Assume independent node filures - Ech node fils with probbility p in mintennce intervl - Sy lef set contins L vlues - Probbility of being cut off is p L - So for lrge N, if L log N, pretty good Is independent filure resonble ssumption? - Good tht nodeid = MD(IP Address) - Proimity in ID spce not correlted with physicl proimity - But big network outges, synchronized renumbering correlted

8 Loclity Lookup tkes O(log n) hops - But hops could be long (NYC Germny LA) Note: Mny options for top levels of routing tble - Cn chose ny node with correct prefi - So pick nodes tht re close to you to speed lookup - But mkes it hrder to ssume independent filures Continuously djust routing tble for loclity - Asks current entry for tht entry s complete tbles - Ping suitble nodes from other node s tbles - Use them insted of current entry if ping sys closer No choice for lef sets, though

9 Short routes property Loclity optimiztion helps recursive lookups - New node will know of nodes close to it - Very good if tringle property holds (X close to Y nd Y close to Z = X close to Z) - Often does hold, but not lwys This is known s short routes property - Individul hops re lower ltency - But less nd less choice (lower node density) s you get close in ID spce - So lst few hops likely to be very long - You don t end up close to the inititing node, just get there more quickly

10 Scribe Pstry cn be used to form multicst trees - Hsh nme of multicst group to get ID - Node closest to ID is rendez-vous point or root - To multicst messge, deliver it do RP, which sends it down the tree Form multicst tree by routing JOIN msgs to ID - Ech node keeps trck of groups + children for ech group - On receipt of JOIN messge, dd sender to children - If child joins new group, send join to prent (prent is just net hop towrds ID) Send just proceeds from RP to leves - Senders cche IP ddress of RP to sve upwrds routing Leve protocol similr to join

11 Scribe loclity Short routes property helps multicst trees - Towrds leves, prents re in high-levels of routing tble - These re precisely the contcts with best loclity - So often delivering messges to nerby nodes - Which my well reduce link stress (eg, node 1bc t NYU will chose node 2defy t NYU over frther nodes) Bottleneck remover lgorithm for overlod - Node my decide it is forwrding too mny copies - Mesures children & boots furthest wy - Booted node effectively gets pushed down the tree

12 Relibility & filure Scribe sends messges over TCP - But doesn t gurntee relibility - Nodes cn crsh nd leve system bruptly - In fct, Sbribe itself doesn t gurntee relible delivery Detect filures using hertbet messges - Ech non-lef node periodiclly sends hertbet to children - Any multicst messge serves s hertbet - So only need etr trffic when group quiescent - Upon timeout, route round filed node in Pstry Must replicte root stte in cse root fils - Typiclly replicted on nerest nodes to ID

13 Relible/ordered multicst Cn build relible/ordered multicst on Scribe Source ssigns sequence number to ech messge - Nodes do not send messges out of order - Wit for ll previous messges before sending net - After fult+repir, you know wht you re missing Nodes buffer old messges - Keep round for longer thn detect+repir time - So when you repir, cn request messges you missed

14 Splitstrem Problem: Scribe mkes uneven use of resources In fully-blnced tree w height h, fnout f - f h lef nodes consume no upstrem b/w - (f h 1)/(f 1) internl nodes consume f strem b/w - Eg, with f = 1, < 10% of nodes crry forwrding lod! Better pproch: Stripe dt over forest of trees - Ech node is lef in some, internl in others - Could round-robin pckets down multicst trees - Or could stripe t the bit level - One tree could be prity bit, to survive filure

15 Interior-node-disjoint trees Wnt to void filure ffecting multiple strems - Eg, sy node n is your ncestor in multiple trees - If n fils, you lose multiple strems (so prity won t help) Solution: Ech node is interior in only one tree - Sy digits re in bse 1 - Cn chieve by hving 1 trees, ech with group ID tht strts with different digit - Cn only be interior node if group ID nd you hve t lest one-digit prefi in common

16 CFS Another ppliction of P2P systems Ide: Replicte widely stored dt in DHT - Eg, Linu distribution - Cre lot bout dt integrity no tmpering! CFS coopertive file system is P2P file system - Red-mostly file system - Publish opertion breks into blocks - Spreds chunks ll round DHT - Digitlly sign entire file system for integrity

17 Emple: Publishing 2 blocks of dt Inde H(dt) H(dt) version epirtion signture dt dt Digitlly sign version & hshes of blocks - Cn verify one block without hving the other - Two blocks must come from sme version of file Generlize technique to n entire file system

18 directory nme i-number Trditionl FS dt structures inode metdt dt ptr dt ptr indirect block contents dt dt indirect ptr double indir dt ptr dt ptr dt dt In dtbse rbitrry key cn replce disk loction

19 CFS dt structures RO-inode contents metdt dt directory H(dt) H(dt) dt indirect nme H(ind blk) block H(inode) H(dbl ind) H(dt) H(dt) dt dt Inde ll dt & metdt with cryptogrphic hsh

20 CFS sclbility & relibility CFS built on Chord not Pstry, but ides similr Blocks must be replicted for relibility - Esy: Store ech item t k successor nodes round circle Blocks must be replicted for sclbility - Eg, Imgine everybody reds the sme block - Don t wnt to overlod poor successor node Solution: Store blocks long the lookup pth - Suppose you re looking up block B on node n 0 - You my trverse nodes n 3, n 2, n 1, n 0 to get B - Now store B on n 1 - Net lookup tht converges t n 1 will store on prev, etc

LECT-10, S-1 FP2P08, Javed I.

LECT-10, S-1 FP2P08, Javed I. A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08

More information

CS 268: IP Multicast Routing

CS 268: IP Multicast Routing Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Infrastructures for Cloud Computing and Big Data

Infrastructures for Cloud Computing and Big Data University of Bologn Diprtimento di Informtic Scienz e Ingegneri (DISI) Engineering Bologn Cmpus Clss of Computer Networks M or Infrstructures for Cloud Computing nd Big Dt ONs nd Advnced Filesystems Antonio

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3

More information

Geometric transformations

Geometric transformations Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Topology-aware routing in structured peer-to-peer overlay networks

Topology-aware routing in structured peer-to-peer overlay networks Topologywre routing in structured peertopeer overly networks Miguel Cstro Peter Druschel Y. Chrlie Hu Antony Rowstron Microsoft Reserch, 7 J J Thomson Close, Cmbridge, C3 F, UK. Rice University, Min Street,

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Secure routing for structured peer-to-peer overlay networks

Secure routing for structured peer-to-peer overlay networks Secure routing for structured peer-to-peer overly networks Miguel Cstro, Peter Druschel 2, Aylvdi Gnesh, Antony Rowstron nd Dn S. Wllch 2 Microsoft Reserch Ltd., 7JJThomson Avenue, Cmbridge, CB3 FB, UK

More information

9 Graph Cutting Procedures

9 Graph Cutting Procedures 9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric

More information

Topology-aware routing in structured peer-to-peer overlay networks

Topology-aware routing in structured peer-to-peer overlay networks Topology-wre routing in structured peer-to-peer overly networks Miguel Cstro ½ Peter Druschel ¾ Y. Chrlie Hu Antony Rowstron ½ ½ Microsoft Reserch, 7 J J Thomson Close, Cmbridge, CB3 FB, UK. ¾ Rice University,

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Epson Projector Content Manager Operation Guide

Epson Projector Content Manager Operation Guide Epson Projector Content Mnger Opertion Guide Contents 2 Introduction to the Epson Projector Content Mnger Softwre 3 Epson Projector Content Mnger Fetures... 4 Setting Up the Softwre for the First Time

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

Scalable Distributed Data Structures: A Survey Λ

Scalable Distributed Data Structures: A Survey Λ Sclble Distributed Dt Structures: A Survey Λ ADRIANO DI PASQUALE University of L Aquil, Itly ENRICO NARDELLI University of L Aquil nd Istituto di Anlisi dei Sistemi ed Informtic, Itly Abstrct This pper

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes

More information

Exploiting network proximity in peer-to-peer overlay networks

Exploiting network proximity in peer-to-peer overlay networks Eploiting network proimity in peer-to-peer overly networks Miguel Cstro Peter Druschel Y. Chrlie Hu Antony Rowstron Microsoft Reserch, J J Thomson Close, Cmbridge, CB3 FB, UK. Rice University, Min Street,

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

Enginner To Engineer Note

Enginner To Engineer Note Technicl Notes on using Anlog Devices DSP components nd development tools from the DSP Division Phone: (800) ANALOG-D, FAX: (781) 461-3010, EMAIL: dsp_pplictions@nlog.com, FTP: ftp.nlog.com Using n ADSP-2181

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Fall 2018 Midterm 2 November 15, 2018

Fall 2018 Midterm 2 November 15, 2018 Nme: 15-112 Fll 2018 Midterm 2 November 15, 2018 Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

COMPUTER EDUCATION TECHNIQUES, INC. (MS_W2K3_SERVER ) SA:

COMPUTER EDUCATION TECHNIQUES, INC. (MS_W2K3_SERVER ) SA: In order to lern which questions hve een nswered correctly: 1. Print these pges. 2. Answer the questions. 3. Send this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following

More information

Reducing Costs with Duck Typing. Structural

Reducing Costs with Duck Typing. Structural Reducing Costs with Duck Typing Structurl 1 Duck Typing In computer progrmming with object-oriented progrmming lnguges, duck typing is lyer of progrmming lnguge nd design rules on top of typing. Typing

More information

Chapter 7. Routing with Frame Relay, X.25, and SNA. 7.1 Routing. This chapter discusses Frame Relay, X.25, and SNA Routing. Also see the following:

Chapter 7. Routing with Frame Relay, X.25, and SNA. 7.1 Routing. This chapter discusses Frame Relay, X.25, and SNA Routing. Also see the following: Chpter 7 Routing with Frme Rely, X.25, nd SNA This chpter discusses Frme Rely, X.25, nd SNA Routing. Also see the following: Section 4.2, Identifying the BANDIT in the Network Section 4.3, Defining Globl

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

Digital Design. Chapter 6: Optimizations and Tradeoffs

Digital Design. Chapter 6: Optimizations and Tradeoffs Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

Phylogeny and Molecular Evolution

Phylogeny and Molecular Evolution Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

Creating Flexible Interfaces. Friday, 24 April 2015

Creating Flexible Interfaces. Friday, 24 April 2015 Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Constrained Optimization. February 29

Constrained Optimization. February 29 Constrined Optimiztion Februry 9 Generl Problem min f( ) ( NLP) s.. t g ( ) i E i g ( ) i I i Modeling nd Constrints Adding constrints let s us model fr more richer set of problems. For our purpose we

More information

MIPS I/O and Interrupt

MIPS I/O and Interrupt MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

EECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining

EECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining EECS150 - Digitl Design Lecture 23 - High-level Design nd Optimiztion 3, Prllelism nd Pipelining Nov 12, 2002 John Wwrzynek Fll 2002 EECS150 - Lec23-HL3 Pge 1 Prllelism Prllelism is the ct of doing more

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam. 15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for

More information

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam. 15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Readings : Computer Networking. Outline. The Next Internet: More of the Same? Required: Relevant earlier meeting:

Readings : Computer Networking. Outline. The Next Internet: More of the Same? Required: Relevant earlier meeting: Redings 15-744: Computer Networking L-14 Future Internet Architecture Required: Servl pper Extr reding on Mobility First Relevnt erlier meeting: CCN -> Nmed Dt Network 2 Outline The Next Internet: More

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

pdfapilot Server 2 Manual

pdfapilot Server 2 Manual pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:

More information

Information regarding

Information regarding Informtion regrding LANCOM Advnced VPN Client 3.13 Copyright (c) 2002-2017 LANCOM Systems GmbH, Wuerselen (Germny) LANCOM Systems GmbH does not tke ny gurntee nd libility for softwre not developed, mnufctured

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Misrepresentation of Preferences

Misrepresentation of Preferences Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from

More information

Epson iprojection Operation Guide (Windows/Mac)

Epson iprojection Operation Guide (Windows/Mac) Epson iprojection Opertion Guide (Windows/Mc) Contents 2 Introduction to Epson iprojection 5 Epson iprojection Fetures... 6 Connection to Vrious Devices... 6 Four-Pnel Disply... 6 Chnge Presenters nd Projection

More information

Bonded Internet. Architecture Examples for Replacing or Enhancing Customer MPLS Networks

Bonded Internet. Architecture Examples for Replacing or Enhancing Customer MPLS Networks Bonded Internet Architecture Exmples for Replcing or Enhncing Customer MPLS Networks Bonded Internet Ensuring business customers hve: Fst, Relible, nd Secure ccess to their Cloud pplictions nd services

More information

VoIP for the Small Business

VoIP for the Small Business Reducing your telecommunictions costs Reserch firm IDC 1 hs estimted tht VoIP system cn reduce telephony-relted expenses by 30%. Voice over Internet Protocol (VoIP) hs become vible solution for even the

More information

VoIP for the Small Business

VoIP for the Small Business Reducing your telecommunictions costs Reserch firm IDC 1 hs estimted tht VoIP system cn reduce telephony-relted expenses by 30%. TechAdvisory.org SME Reports sponsored by Voice over Internet Protocol (VoIP)

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

VoIP for the Small Business

VoIP for the Small Business VoIP for the Smll Business Reducing your telecommunictions costs Reserch firm IDC 1 hs estimted tht VoIP system cn reduce telephony-relted expenses by 30%. Voice over Internet Protocol (VoIP) hs become

More information

The Distributed Data Access Schemes in Lambda Grid Networks

The Distributed Data Access Schemes in Lambda Grid Networks The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn

More information

Supporting Complex Multi-dimensional Queries in P2P Systems

Supporting Complex Multi-dimensional Queries in P2P Systems Supporting Complex Multi-dimensionl Queries in P2P Systems Bin Liu Wng-Chien Lee Di Lun Lee Deprtment of Computer Science Hong Kong University of Science nd Technology Deprtment of Computer Science nd

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

VoIP for the Small Business

VoIP for the Small Business Reducing your telecommunictions costs Reserch firm IDC 1 hs estimted tht VoIP system cn reduce telephony-relted expenses by 30%. Voice over Internet Protocol (VoIP) hs become vible solution for even the

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

I/O Efficient Dynamic Data Structures for Longest Prefix Queries

I/O Efficient Dynamic Data Structures for Longest Prefix Queries I/O Efficient Dynmic Dt Structures for Longest Prefix Queries Moshe Hershcovitch 1 nd Him Kpln 2 1 Fculty of Electricl Engineering, moshik1@gmil.com 2 School of Computer Science, himk@cs.tu.c.il, Tel Aviv

More information