Miseq spec, process and turnaround times
|
|
|
- Oswald Hall
- 5 years ago
- Views:
Transcription
1 Miseq spec, process and turnaround s One Single lane & library pool / flow cell (on board clusterisation) 1 Flow cell / run Instrument used to sequence small libraries such as targeted sequencing or bacterial genomes, and titrations steps. start end Data delivery 1 2 weeks Total for sequencing : 1 2 weeks Miseq Reagent kits V2 Miseq Reagent kits V3 Read length Output Read length Output 1 36 bp ± 4 hrs Mb 2 75 bp ± 21 hrs 3,3 3,8 Gb 2 25 bp ± 5,5 hrs Mb bp ± 56 hrs Gb bp ± 24 hrs 4,5 5,1 Gb 2 x 250 bp ± 39 hrs 7,8 8,5 Gb Reads Passing Filter kits v2 kits v3 Single Reads 12 15M 22 25M Paired end reads M M Page 1 sur 5
2 NextSeq500 spec, process and turnaround s Two Modes :High Output = HO Mid Output = MO 4 non separated lanes = one library pool / flow cell (on board clusterisation) 1 flow cell / run Instrument used to sequence medium size libraries such as targeted sequencing or a few RNA and WES (WES: for small projects such as 3-6 captures, to get approx. 100x coverage, we recommend to process 3 libraries with MO mode, 6 libraries with HO mode). 1 2 weeks start end Data delivery See Illumina spec document Total for sequencing : 1 2 weeks Nextseq500 HO kit MO kit Read length Output Output 2 x 150 bp ± 29 hrs Gb ± 26 hrs Gb 2 75 bp ± 18 hrs Gb ± 15 hrs Gb 1 75 bp ± 11 hrs Gb Reads Passing Filter HO MO Single Reads Up to 400 M Up to 130 M Paired end reads Up to 800 M Up to 260 M Page 2 sur 5
3 HiSeq2500 spec, process and turnaround s Two modes : High Output = HO Rapid run HO 8 lanes up to 8 different library pools / flow cell (clusterisation on CBot) up to 2 flow cell / run Mode used to sequence large libraries such as large genomes, RNA, RAD, or WES (WES to get approx. 100x coverage, we recommend to process 16 librairies). start end Data delivery See Illumina spec document Total for sequencing : 3 5 weeks HiSeq2500 HO kit v3 DUAL Flow Cell SINGLE Flow Cell per LANE Read length Output Output Output bp ± 11 days Gb Gb Gb 2 x 50 bp ± 5,5 days Gb Gb Gb 1 x 100 bp ± 5,5 days Gb Gb Gb 1 36 bp ± 2 days Gb Gb 5 6 Gb Reads Passing Filter dual Flow cell Single Flow cell Per lane Single Reads Up to 3 billion Up to 1,5 billion Up to 187 M Paired end reads Up to 6 billions Up to 3 billion Up to 375 M Page 3 sur 5
4 HiSeq2500 spec, process and turnaround s Rapid Mode 2 lanes up to 2 different library pools / flow cell: 1 unique pool to sequence: ON BORD clusterisation 2 different pools to sequence: CBot clusterisation up to 2 flow cell / run Mode used to sequence large libraries such as large genomes, RNA, RAD, or WES (WES to get approx. 100x coverage, we recommend to process 16 libraries). start end Data delivery Total for sequencing : 1 2 weeks HiSeq2500 kits v2 DUAL Flow Cell SINGLE Flow Cell per LANE Read length Output Output Output bp ± 60 hrs Gb Gb Gb bp ± 40 hrs Gb Gb Gb bp ± 27 hrs Gb Gb Gb 2 x 50 bp ± 16 hrs Gb Gb Gb 1 x 100 bp ± 16 hrs Gb Gb Gb 1 36 bp ± 7 hrs Gb 9 11 Gb 4 5 Gb Reads Passing Filter dual Flow cell Single Flow cell Per lane Single Reads Up to 600 M Up to 300 M Up to 150 M Paired end reads Up to 1,2 billion Up to 600 M Up to 300 M Page 4 sur 5
5 HiSeq4000 spec, process and turnaround s A unique mode: High Output: 8 lanes up to 8 different library pools / flow cell (clusterisation on CBot) up to 2 flow cell / run Mode used to sequence large libraries such as large genomes, RNA, or WES. start end Data delivery Total for sequencing : 2 4 weeks HiSeq4000 HO kit v3 DUAL Flow Cell SINGLE Flow Cell per LANE Read length Output Output Output bp ± 5 days Gb Gb Gb 2 x 75 bp ± 3 days Gb Gb Gb 2 x 100 bp ± 3,5 days Gb Gb Gb 1 x 150 bp ± 3 days Gb Gb Gb 1 50 bp ± 1,5 days Gb Gb Gb Cluster Passing Filter dual Flow cell Single Flow cell Per lane Single Reads Up to 5 billion Up to 2,5 billion UP to 312 M Paired ends reads Up to 10 billion Up to 5 billion Up to 625 M Page 5 sur 5
Illumina Experiment Manager: Narration Transcript
1 Illumina Experiment Manager: Transcript... 1 Illumina Experiment Manager: Transcript Welcome Course Navigation Course Objectives Overview Downloading the Software Sample Sheets and Sample Plates Terms
Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits
Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the
Sequencing set-up guidelines for NGS libraries prepped with Agilent NGS kits
Sequencing set-up guidelines for NGS libraries prepped with Agilent NGS kits I. Illumina Instruments (SureSelect XT /XT2/QXT, SurSelect RNA-Seq and HaloPlex/HaloPlex HS ) 1. HiSeq1000/2000 and HiSeq1500/2500
User Guide: Illumina sequencing technologies Sequence-ready libraries
DECEMBER 17, 2018 MASSIVELY PARALLEL SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre User Guide: Illumina sequencing technologies Sequence-ready libraries Version 6.0 Copyright
Indexed Sequencing. Overview Guide
Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read
Install Notes cbot v Recipe Installer For cbot
Install Notes cbot v2.0.16 Recipe Installer 2.0.3 For cbot cbot 2.0.16 Install Notes 1 Introduction These instructions detail how to install cbot software version 2.0.16. These update instructions apply
Image Analysis and Base Calling Sarah Reid FAS
Image Analysis and Base Calling Sarah Reid FAS For Research Use Only. Not for use in diagnostic procedures. 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse,
Indexed Sequencing. Overview Guide
Indexed Sequencing Overview Guide Introduction 3 Single-Indexed Sequencing Overview 3 Dual-Indexed Sequencing Overview 4 Dual-Indexed Workflow on a Paired-End Flow Cell 4 Dual-Indexed Workflow on a Single-Read
Illumina Experiment Manager User Guide
Illumina Experiment Manager User Guide For Research Use Only. Not for use in diagnostic procedures. What is Illumina Experiment Manager? 3 Getting Started 4 Creating a Sample Plate 7 Creating a Sample
Guidelines for sequencing SCC libraries All libraries made after are V3 libraries
2018-2-28 Guidelines for sequencing SCC libraries All libraries made after 1-1-2017 are V3 libraries Upon receiving your libraries: When your libraries are delivered you will be given the library concentration
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed
Prof. Konstantinos Krampis Office: Rm. 467F Belfer Research Building Phone: (212) Fax: (212)
Director: Prof. Konstantinos Krampis agbiotec@gmail.com Office: Rm. 467F Belfer Research Building Phone: (212) 396-6930 Fax: (212) 650 3565 Facility Consultant:Carlos Lijeron 1/8 carlos@carotech.com Office:
HiSeq Instrument Software Release Notes
HiSeq Instrument Software Release Notes HCS v2.0.12 RTA v1.17.21.3 Recipe Fragments v1.3.61 Illumina BaseSpace Broker v2.0.13022.1628 SAV v1.8.20 For HiSeq 2000 and HiSeq 1000 Systems FOR RESEARCH USE
TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq
TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Powered by SMART and LNA technologies: Locked nucleic acid technology significantly improves
1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central
1. PURPOSE: to describe a standardized procedure for Illumina MiSeq data quality control (QC) before upload to PulseNet Central 2. SCOPE: This procedure applies to all clinical isolates that are whole
BaseSpace User Guide. Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY
BaseSpace User Guide Supporting the NextSeq, MiSeq, and HiSeq Sequencing Systems FOR RESEARCH USE ONLY Introduction 3 How Do I Start 8 BaseSpace User Interface 13 How To Use BaseSpace 25 Workflow Reference
High-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
Nevada Genomics Center
Nevada Genomics Center These are general instructions on how to use dnatools to submit next generation sequencing samples to be run on either the Ion Torrent Proton or the Illumina NextSeq500. We here
Omega: an Overlap-graph de novo Assembler for Metagenomics
Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n
MiSeq System User Guide
MiSeq System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 15027617 Rev. A August 2011 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and
MiSeq System User Guide
MiSeq System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part # 15027617 Rev. H March 2013 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and
Sequencing Analysis Viewer Software User Guide
Sequencing Analysis Viewer Software User Guide FOR RESEARCH USE ONLY Revision History 3 Introduction 4 Setting Up Sequencing Analysis Viewer Software 5 Data Availability 8 Loading Data 9 Analysis Tab 10
Terabases of long-read sequence data, analysed in real time
Terabases of long-read sequence data, analysed in real time The PromethION is a real game changer. Combining ultra-long reads with high sequence output for the production of contiguous, highquality reference
Accelerating Genomic Sequence Alignment Workload with Scalable Vector Architecture
Accelerating Genomic Sequence Alignment Workload with Scalable Vector Architecture Dong-hyeon Park, Jon Beaumont, Trevor Mudge University of Michigan, Ann Arbor Genomics Past Weeks ~$3 billion Human Genome
Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab
The instruments, the runs, the QC metrics, and the output Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab Overview Roche/454 GS-FLX 454 (GSRunbrowser information) Evaluating run results Errors
BaseSpace Onsite v2.1 HT System Guide
BaseSpace Onsite v2.1 HT System Guide For Research Use Only. Not for use in diagnostic procedures. Revision History 6 Introduction 7 Getting Started 12 BaseSpace Onsite User Interface 17 How To Use BaseSpace
Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
Kraken: ultrafast metagenomic sequence classification using exact alignments
Kraken: ultrafast metagenomic sequence classification using exact alignments Derrick E. Wood and Steven L. Salzberg Bioinformatics journal club October 8, 2014 Märt Roosaare Need for speed Metagenomic
MiSeqDx Reference Guide
MiSeqDx Reference Guide for Instruments with Dual Boot Configuration FOR IN VITRO DIAGNOSTIC USE ILLUMINA PROPRIETARY Document # 15070067 Rev. 03 September 2017 This document and its contents are proprietary
README _EPGV_DataTransfer_Illumina Sequencing
README _EPGV_DataTransfer_Illumina Sequencing I. Delivered files / Paired-ends (PE) sequences... 2 II. Flowcell (FC) Nomenclature... 2 III. Quality Control Process and EPGV Cleaning Version 1.7... 4 A.
CORE Year 1 Whole Genome Sequencing Final Data Format Requirements
CORE Year 1 Whole Genome Sequencing Final Data Format Requirements To all incumbent contractors of CORE year 1 WGS contracts, the following acts as the agreed to sample parameters issued by NHLBI for data
Lessons Learned during Illumina s Secure DevOps Transition Kenneth G. Hartman Associate Director Cloud Products Security
Lessons Learned during Illumina s Secure DevOps Transition Kenneth G. Hartman Associate Director Cloud Products Security 2018 Illumina, Inc. All rights reserved. QB Document #6608 At a Glance 2 https://www.illumina.com/company/news-center/feature-articles/illumina-at-a-glance.html
HiScan SQ System User Guide
HiScan SQ System User Guide FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Document # 15015392 v01 March 2018 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"),
GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units
GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units Abstract A very popular discipline in bioinformatics is Next-Generation Sequencing (NGS) or DNA sequencing. It specifies
iscan System Site Prep Guide
iscan System Site Prep Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Delivery and Installation 4 Laboratory Requirements 5 Electrical Requirements 7 Uninterruptible
mtdna Variant Processor v1.0 BaseSpace App Guide
mtdna Variant Processor v1.0 BaseSpace App Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Workflow Diagram 4 Workflow 5 Log In to BaseSpace 6 Set Analysis Parameters
Sequencing CTRII Tulane University
RNA-Seq Sample Submission Form Please complete this form before submitting samples to the CTRII at Tulane University. We cannot accept samples unless accompanied by this form. 1. Contact Information PI
Tutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017
RNA-Seq Analysis of Breast Cancer Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com
Importing your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
Package savr. R topics documented: October 12, 2016
Type Package Title Parse and analyze Illumina SAV files Version 1.10.0 Date 2015-07-28 Author R. Brent Calder Package savr October 12, 2016 Maintainer R. Brent Calder Parse
Package savr. R topics documented: March 2, 2018
Type Package Title Parse and analyze Illumina SAV files Version 1.17.0 Date 2015-07-28 Author R. Brent Calder Package savr March 2, 2018 Maintainer R. Brent Calder Parse
ADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD
ADNI Sequencing Working Group Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD Why sequencing? V V V V V V V V V V V V V A fortuitous relationship TIME s Best Invention of 2008 The initial
1. HPC & I/O 2. BioPerl
1. HPC & I/O 2. BioPerl A simplified picture of the system User machines Login server(s) jhpce01.jhsph.edu jhpce02.jhsph.edu 72 nodes ~3000 cores compute farm direct attached storage Research network
LIMS User Guide 1. Content
LIMS User Guide 1. Content 1. Content... 1 1. Introduction... 2 2. Get a user account... 2 3. Invoice Address... 2 Create a new invoice address... 2 4. Create Project Request... 4 Request tab... 5 Invoice
Install Notes HCS RTA SAV Recipe Fragments (RF) BaseSpace Broker For HiSeq 2500, 2000, or 1500 Instruments
Install Notes HCS 2.2.38 RTA 1.18.61 SAV 1.8.37 Recipe Fragments (RF) 1.5.14 BaseSpace Broker 2.1.0.1 For HiSeq 2500, 2000, or 1500 Instruments Introduction This document describes the installation process
DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure
TM DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure About DRAGEN Edico Genome s DRAGEN TM (Dynamic Read Analysis for GENomics) Bio-IT Platform provides ultra-rapid secondary analysis of
Illumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
CircuitsMulti-Projets
From layout to chips CircuitsMulti-Projets MPW Services Center for ICs, Photonics & MEMS Prototyping & Low Volume Production mycmp.fr Grenoble - France From layout to chips STMicroelectronics Standard
Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
NGS NEXT GENERATION SEQUENCING
NGS NEXT GENERATION SEQUENCING Paestum (Sa) 15-16 -17 maggio 2014 Relatore Dr Cataldo Senatore Dr.ssa Emilia Vaccaro Sanger Sequencing Reactions For given template DNA, it s like PCR except: Uses only
SMALT Manual. December 9, 2010 Version 0.4.2
SMALT Manual December 9, 2010 Version 0.4.2 Abstract SMALT is a pairwise sequence alignment program for the efficient mapping of DNA sequencing reads onto genomic reference sequences. It uses a combination
Local Run Manager Resequencing Analysis Module Workflow Guide
Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis
Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018)
Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018) Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering
GBS Bioinformatics Pipeline(s) Overview
GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Terry Casstevens With supporting information from
Cloud computing for genome science and methods
Cloud computing for genome science and methods Ben Langmead Department of Biostatistics Sequencing throughput GA II 1.6 billion bp per day (2008) GA IIx 5 billion bp per day (2009) HiSeq 2000 25 billion
Local Run Manager Amplicon Analysis Module Workflow Guide
Local Run Manager Amplicon Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 9 Analysis Report
EXERCISE: GETTING STARTED WITH SAV
Sequencing Analysis Viewer (SAV) Overview 1 EXERCISE: GETTING STARTED WITH SAV Purpose This exercise explores the following topics: How to load run data into SAV How to explore run metrics with SAV Getting
Illumina GA. later. RTA1.9. very number. older style
SCS 2.9/RTA 1.9 Release Notes SCS2.9 / RTA1.9 Release Notes 2 I. Introduction These release notes outline new and revised functionality inn the Sequencing Control Studio (SCS) Version 2.9 with Real Time
Contact: Raymond Hovey Genomics Center - SFS
Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad
RNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
Best Practices for Illumina Genome Analysis Based on Huawei OceanStor 9000 Big Data Storage System. Huawei Technologies Co., Ltd.
Best Practices for Illumina Genome Analysis Based on Huawei OceanStor 9000 Big Data Storage With the rapid development of society, economy, science, and technology as well as improvement of living standards,
FlexRIO. FPGAs Bringing Custom Functionality to Instruments. Ravichandran Raghavan Technical Marketing Engineer. ni.com
FlexRIO FPGAs Bringing Custom Functionality to Instruments Ravichandran Raghavan Technical Marketing Engineer Electrical Test Today Acquire, Transfer, Post-Process Paradigm Fixed- Functionality Triggers
Mountain Corridor Incident Management Program
Mountain Corridor Incident Management Program Colorado Department of Transportation Background The I- Incident Management study was initiated in response to CDOT s I- MIS. The resulting program was the
MiSeq Reporter Software Reference Guide for IVD Assays
MiSeq Reporter Software Reference Guide for IVD Assays FOR IN VITRO DIAGNOSTIC USE ILLUMINA PROPRIETARY Document # 15038356 Rev. 02 September 2017 This document and its contents are proprietary to Illumina,
Understanding and Pre-processing Raw Illumina Data
Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format
EcoStudy Software User Guide
EcoStudy Software User Guide FOR RESEARCH USE ONLY What is EcoStudy? 3 Setting Up a Study 4 Specifying Analysis Settings for your Study 6 Reviewing the Data in your Study 8 Exporting Study Data to a Report
Welcome. Jeremy Poon Territory Manager, VMware
Welcome Jeremy Poon Territory Manager, VMware Partner Recognition VMware Infrastructure The New Computing Platform Presented by: Yasser Elgammal Regional Director, VMware VMware: Who We Are World s leading
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus
Sequence Genotyper Reference Guide
Sequence Genotyper Reference Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Installation 4 Dashboard Overview 5 Projects 6 Targets 7 Samples 9 Reports 12 Revision History
BaseSpace - MiSeq Reporter Software v2.4 Release Notes
Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History
VON NEUMANN ARCHITECTURE. VON NEUMANN ARCHITECTURE IB DP Computer science Standard Level ICS3U
C A N A D I A N I N T E R N A T I O N A L S C H O O L O F H O N G K O N G 5.3 Putting all the Units Together the Von Neumann Architecture 5.4 s Von Neumann Architecture the four components that make up
2020 Tablet Setup & FAQ s March Daimler Trucks
2020 Tablet Setup & FAQ s March 2017 Daimler Trucks Step by step instructions for ordering the Zonar 2020 Tablet 1. Spec truck with 813-1B7 Tablet Prep (wiring, docking station)*. Include selected tablet
Fully Featured Eddy Current Conductivity Meter ET NDE
Fully Featured Eddy Current Conductivity Meter ET NDE Introducing The SigmaCheck APPLICATIONS Material Verification / Metal Sorting. Heat Treatment Verification. Heat or Fire Damage Investigation. Non-conductive
Industrial Automation and Emerging Single-pair Ethernet
Industrial Automation and Emerging Single-pair Ethernet David D. Brandt Rockwell Automation IEEE 802.3 10Mbps Single-Pair Ethernet Study Group Ad Hoc - Sept. 2016 Interim Meeting, Ft Worth, TX USA Page
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on
DBG2OLC: Efficient Assembly of Large Genomes Using Long Erroneous Reads of the Third Generation Sequencing Technologies
DBG2OLC: Efficient Assembly of Large Genomes Using Long Erroneous Reads of the Third Generation Sequencing Technologies Chengxi Ye 1, Christopher M. Hill 1, Shigang Wu 2, Jue Ruan 2, Zhanshan (Sam) Ma
BIT 815: Analysis of Deep DNA Sequencing Data
BIT 815: Analysis of Deep DNA Sequencing Data Overview: This course covers methods for analysis of data from high-throughput DNA sequencing, with or without a reference genome sequence, using free and
Overview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University
Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University Overview of the Data Analysis Strategy Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( )
Meraculous De Novo Assembly of the Ariolimax dolichophallus Genome. Charles Cole, Jake Houser, Kyle McGovern, and Jennie Richardson
Meraculous De Novo Assembly of the Ariolimax dolichophallus Genome Charles Cole, Jake Houser, Kyle McGovern, and Jennie Richardson Meraculous Assembler Published by the US Department of Energy Joint Genome
SteelHead Product Family
Specification Sheet 11.15.18 SteelHead Product Family SteelHead CX Branch Office SteelHead Mid-Size Office SteelHead CX255 Series CX570 Series CX770 Series Configurations U L M H L M H L M H Profile Desktop
Service Reminder Indicator (SRI), resetting
36 Service Reminder Indicator (SRI), resetting The Service Reminder Indicator (SRI) must be reset during the pre-delivery inspection and after each oil change service or inspection service. Pre-delivery
HiSeq X System Lab Setup and Site Prep Guide
HiSeq X System Lab Setup and Site Prep Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Delivery and Installation 4 Principles of Production Lab Layout and Design 5 Space
SMRT Link Release Notes (v6.0.0)
SMRT Link Release Notes (v6.0.0) SMRT Link Server Installation SMRT Link server software is supported on English-language CentOS 6.x; 7.x and Ubuntu 14.04; 16.04 64-bit Linux distributions. (This also
Ensembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
Sequence Data Quality Assessment Exercises and Solutions.
Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and
HiScanSQ System Site Preparation Guide
HiScanSQ System Site Preparation Guide FOR RESEARCH USE ONLY Introduction 3 Supported Configurations 4 User-Supplied Equipment and Materials 5 Delivery and Installation 6 Operation, Maintenance, and Service
The knight makes his play for the crown Phi & Omni-Path Glenn Rosenberg Computer Insights UK 2016
The knight makes his play for the crown Phi & Omni-Path Glenn Rosenberg Computer Insights UK 2016 2016 Supermicro 15 Minutes Two Swim Lanes Intel Phi Roadmap & SKUs Phi in the TOP500 Use Cases Supermicro
Bioinformatics Services for HT Sequencing
Bioinformatics Services for HT Sequencing Tyler Backman, Rebecca Sun, Thomas Girke December 19, 2008 Bioinformatics Services for HT Sequencing Slide 1/18 Introduction People Service Overview and Rates
BaseSpace User Guide FOR RESEARCH USE ONLY
BaseSpace User Guide FOR RESEARCH USE ONLY Introduction 3 How Do I Start 7 BaseSpace User Interface 11 How To Use BaseSpace 21 Workflow Reference 44 Data Reference 50 Technical Assistance ILLUMINA PROPRIETARY
Introduction. Library quantification and rebalancing. Prepare Library Sequence Analyze Data. Library rebalancing with the iseq 100 System
Sequencing Library QC with the iseq System The iseq 100 System enables measurement of pooled library quality before a large-scale sequencing study on the NovaSeq 6000 System. Introduction This application
Darwin: A Hardware-acceleration Framework for Genomic Sequence Alignment
Darwin: A Hardware-acceleration Framework for Genomic Sequence Alignment Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering and Computer Science) Prof. Gill Bejerano
State of IT. June 2, 2005 By William Lewis, CIO
State of IT June 2, 2005 By William Lewis, CIO ABOR Issues/Pressures Centralization of Administrative Systems IT Architectural Standards Project Review FUNDING PRESSURES Increasing Demands for Resources
Agilent 2100 Bioanalyzer System & Applications Site Preparation Checklist
Thank you for purchasing an Agilent instrument. To get you started and to assure a successful and timely installation, please refer to this specification or set of requirements. Correct site preparation
Customer Responsibilities
Thank you for purchasing an Agilent instrument. To get you started and to assure a successful and timely installation, please refer to this specification or set of requirements. Correct site preparation
All About PlexSet Technology Data Analysis in nsolver Software
All About PlexSet Technology Data Analysis in nsolver Software PlexSet is a multiplexed gene expression technology which allows pooling of up to 8 samples per ncounter cartridge lane, enabling users to
Illumina LIMS User Guide
This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the contractual use of its customer in connection with the use of the product(s)
NextGenMap and the impact of hhighly polymorphic regions. Arndt von Haeseler
NextGenMap and the impact of hhighly polymorphic regions Arndt von Haeseler Joint work with: The Technological Revolution Wetterstrand KA. DNA Sequencing Costs: Data from the NHGRI Genome Sequencing Program
Physical Memory Recommendations for Cisco CallManager Version 4.0 and later
Product Bulletin No. 2864 Physical Recommendations for Cisco CallManager Version 4.0 and later Cisco CallManager Version 4.0 provides many improvements to security, interoperability, functionality, and