Correcting the Dynamic Call Graph Using Control Flow Constraints
|
|
- Darleen Manning
- 5 years ago
- Views:
Transcription
1 Correting the Dynmi Cll Grph Using Control Flow Constrints Byeongheol Lee Kevin Resnik Mihel Bond Kthryn MKinley 1 Appered in CC2007
2 Motivtion Complexity of lrge objet oriented progrms Deompose the progrm into smll methods Method boundry beomes performne-bottlenek Dynmi interproedurl optimiztion Solve the method boundry problem Inlining nd speiliztion vry the performne by ftor of 2 Dynmi ll grph (DCG) is ritil input! b w 1 2 w 2 Dynmi ll grph
3 Inurte ll grph 1,000 b ll b ll 500 Error DCG Smple method 3
4 Timer-bsed smpling nd timing bis Cll stk b b b b t 4
5 Timer-bsed smpling nd timing bis Cll stk b b b b t 5
6 Timer-bsed smpling nd timing bis Cll stk b b b b t 6
7 Timer-bsed smpling nd timing bis Cll stk b b b b t 7
8 Timer-bsed smpling nd timing bis timer tik timer tik timer tik timer tik Cll stk b b b b t DCG Smple b b b b 8
9 Overhed nd ury in ll grph profiling 25 Full instrumenttion Overhed (%) Arnold-Grove smpling [2005] Timer-bsed smpling [2000] Aury (%) Corretion [2007] 100
10 Outline Motivtion Cll grph orretion Evlution 10
11 Timing bis in SPEC JVM98 rytre Smpling Normlized frequeny(%) Method lls grouped by soure method 11
12 Timing bis in SPEC JVM98 rytre Normlized frequeny(%) Method lls grouped by soure method 12
13 Corretion lgorithms Detet nd orret DCG error DCG onstrint Stti nd dynmi pprohes New Stti FDOM (Frequeny domintor) orretion Stti pproh Uses stti FDOM onstrint on DCG Dynmi bsi blok profile orretion Dynmi pproh Uses dynmi bsi blok profile onstrint on DCG 13
14 Stti FDOM onstrint FDOM onstrint on CFG ll is exeuted t lest s mny times s ll b ll FDOM ll b FDOM onstrint on DCG f( ) f( b ) ll b ll method 14
15 Stti FDOM orretion FDOM onstrint: f( ) f( b ) 1,000 b Corretion 750 b DCG Smple DCG FDOMCorretion 15 Detet error nd ssign the sme verge frequeny One possible solution to the FDOM onstrint Preserve totl frequeny sum
16 Dynmi bsi blok profile onstrint Some dynmi optimiztion systems do edge profiling Bseline ompiler in Jikes RVM 16 Dynmi bsi blok profile onstrint on CFG f(ll ) = 2 * f(ll b) Dynmi bsi blok profile onstrint on DCG f( ) = 2 * f( ) b method 50% 50% ll b ll
17 Dynmi bsi blok profile orretion Constrint: f( ) = 2* f( b ) 1,000 b Corretion 500 b 500 1,000 DCG Smple DCG EdgeProfileCorretion 17 f New ( b ) = 1/(1+2) * (1, ) = 500 f New ( ) = 2/(1+2) * (1, ) = 1,000
18 18 Best result: rytre 5 Normlized frequeny(%) Normlized frequeny(%) Normlized frequeny(%) Smpling Stti FDOM orretion 0 Dynmi bsi blok profile orretion
19 Outline Motivtion Cll grph orretion Evlution 19
20 Experimentl methodology Jikes RVM on 3.2G Pentium 4 Reply methodology [Blkburn et l. 06] Deterministi run 1 st itertion ompiltion + pplition run 2 nd itertion pplition run Mesurement Aury Use overlp ury [Arnold & Grove 05] Overhed 1 st itertion inludes ll grph orretion Performne 2 nd itertion is pplition-only SPECJVM98 nd DCpo benhmrks 20
21 21 Aury ompress jess Aury(%) rytre db jv mpegudio mtrt jk ntlr blot fop hsqldb jython luindex ipsixql jbb Averge No orretion Stti FDOM orretion Dynmi bsi blok profile orretion
22 22 Overhed ompress jess rytre Normlized exeution time db jv mpegudio mtrt jk ntlr blot fop hsqldb jython luindex ipsixql jbb Averge Stti FDOM Corretion Dynmi bsi blok profile orretion
23 23 Inlining performne Stti FDOM Corretion Dynmi bsi blok Profile orretion Perfet DCG ompress jess rytre db jv mpegudio mtrt jk ntlr blot fop hsqldb jython luindex ipsixql jbb Averge Normlized exeution time Bseline: profile-guided inlining with defult ll grph smpling
24 Summry CFG onstrint improves the DCG Inlining hs been tuned for bd ll grph Advntges Cn be esily ombined with other DCG profiling Miniml overhed only during the ompiltion Future work More inter-proedurl optimiztions with high ury DCG 24
25 Question nd omment Thnk you! 25
26 26
27 27
28 28
29 29
30 Timing bis misleds optimizer 5,000 times 10,000 times b Smpling with timing bis 1,000 smples 500 smples b DCG Perfet DCG Smple 30 DCG Smple Edge frequenies were reversed! Inlining deision Inliner my inline b insted of
31 Cll grph profiling in online optimiztion system Soure progrm e.g. Jv byte ode Compile & instrument Dynmi ll grph Mhine ode Online optimiztion system 31 Profiling nd progrm run t the sme time Minimize profiling overhed Corollry: srifie profiling ury
Minimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationCS453 INTRODUCTION TO DATAFLOW ANALYSIS
CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationDemand-Driven Context-Sensitive Alias Analysis for Java
Demnd-Driven Context-Sensitive Alis Anlysis or Jv Dcong (Tony) Yn Guoqing (Hrry) Xu Atns Rountev Ohio Stte University PRESTO: Progrm Anlyses nd Sotwre Tools Reserch Group, Ohio Stte University Alis Anlysis
More informationProbabilistic Calling Context
Probabilistic Calling Context Michael D. Bond Kathryn S. McKinley University of Texas at Austin Why Context Sensitivity? Static program location not enough at com.mckoi.db.jdbcserver.jdbcinterface.execquery():213
More informationTight triangulations: a link between combinatorics and topology
Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited
More informationProgram Calling Context. Motivation
Program alling ontext Motivation alling context enhances program understanding and dynamic analyses by providing a rich representation of program location ollecting calling context can be expensive The
More informationSOFTWARE-BUG LOCALIZATION WITH GRAPH MINING
Chpter 17 SOFTWARE-BUG LOCALIZATION WITH GRAPH MINING Frnk Eihinger Institute for Progrm Strutures nd Dt Orgniztion (IPD) Universit-t Krlsruhe (TH), Germny eihinger@ipd.uk.de Klemens B-ohm Institute for
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationTowards Parallel, Scalable VM Services
Towards Parallel, Scalable VM Services Kathryn S McKinley The University of Texas at Austin Kathryn McKinley Towards Parallel, Scalable VM Services 1 20 th Century Simplistic Hardware View Faster Processors
More informationIntelligent Compilation
Intelligent Compilation John Cavazos Department of Computer and Information Sciences University of Delaware Autotuning and Compilers Proposition: Autotuning is a component of an Intelligent Compiler. Code
More informationOutline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP
ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression
More informationCompiler-Assisted Cache Replacement
LCPC 3 Formulting The Prolem of Compiler-Assisted Cche Replcement Hongo Yng LCPC 3 Agend Bckground: Memory hierrchy, ISA with cche hints Prolem definition: How should compiler give cche hint to minimize
More informationChapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationData Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.
Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized
More informationThe Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline
CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The
More informationCS 268: IP Multicast Routing
Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationAdaptive Optimization using Hardware Performance Monitors. Master Thesis by Mathias Payer
Adaptive Optimization using Hardware Performance Monitors Master Thesis by Mathias Payer Supervising Professor: Thomas Gross Supervising Assistant: Florian Schneider Adaptive Optimization using HPM 1/21
More informationSMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS
Progress In Eletromgnetis Reserh C, Vol. 3, 195 22, 28 SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS W.-L. Chen nd G.-M. Wng Rdr Engineering Deprtment Missile Institute of Air Fore Engineering
More informationOutline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations
CS 412/413 Introduction to Compilers nd Trnsltors Cornell University Andrew Myers Outline Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings
More informationCOSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview
COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationCompiling a Parallel DSL to GPU
Compiling Prllel DSL to GPU Rmesh Nrynswmy Bdri Gopln Synopsys In. Synopsys 2012 1 Agend Overview of Verilog Simultion Prllel Verilog Simultion Algorithms Prllel Simultion Trdeoffs on GPU Chllenges Synopsys
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationTriple/Quadruple Patterning Layout Decomposition via Novel Linear Programming and Iterative Rounding
Triple/Qudruple Ptterning Lyout Deomposition vi Novel Liner Progrmming nd Itertive Rounding Yio Lin, Xioqing Xu, Bei Yu, Ross Bldik nd Dvid Z. Pn ECE Dept., University of Texs t Austin, Austin, TX USA
More informationMITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam
Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationAnswer Key Lesson 6: Workshop: Angles and Lines
nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power
More informationA distributed edit-compile workflow
Time Synhroniztion nd Logil Cloks Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion 3. Logil Time: Lmport Cloks COS 418: Distriuted Systems Leture 4 Kyle Jmieson 2 A distriuted edit-ompile
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationCone Cluster Labeling for Support Vector Clustering
Cone Cluster Lbeling for Support Vector Clustering Sei-Hyung Lee Deprtment of Computer Science University of Msschusetts Lowell MA 1854, U.S.A. slee@cs.uml.edu Kren M. Dniels Deprtment of Computer Science
More informationAccurate Indirect Branch Prediction
Aurte Indiret Brnh Predition Krel Driesen nd Urs Hölzle Deprtment of Computer Siene University of Cliforni Snt Brbr, CA 9 Abstrt Indiret brnh predition is likely to beome inresingly importnt in the future
More informationII. THE ALGORITHM. A. Depth Map Processing
Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationCOSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup
COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition
More informationPhase-based Adaptive Recompilation in a JVM
Phase-based Adaptive Recompilation in a JVM Dayong Gu Clark Verbrugge Sable Research Group, School of Computer Science McGill University, Montréal, Canada {dgu1, clump}@cs.mcgill.ca April 7, 2008 Sable
More informationHow s the Parallel Computing Revolution Going? Towards Parallel, Scalable VM Services
How s the Parallel Computing Revolution Going? Towards Parallel, Scalable VM Services Kathryn S McKinley The University of Texas at Austin Kathryn McKinley Towards Parallel, Scalable VM Services 1 20 th
More informationJava Performance Evaluation through Rigorous Replay Compilation
Java Performance Evaluation through Rigorous Replay Compilation Andy Georges Lieven Eeckhout Dries Buytaert Department Electronics and Information Systems, Ghent University, Belgium {ageorges,leeckhou}@elis.ugent.be,
More informationComplete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
More informationShared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion
Tody s Outline Arhitetures Progrmming nd Synhroniztion Disuss pper on Cosmi Cube (messge pssing) Messge pssing review Cosmi Cube disussion > Messge pssing mhine Shred memory model > Communition > Synhroniztion
More informationOutline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers
CS 412 Introduction to Compilers Andrew Myers Cornell University Lectur8 Finishing genertion 9 Mr 01 Outline Tiling s syntx-directed trnsltion Implementing function clls Implementing functions Optimizing
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationDebunking Dynamic Optimization Myths
Debunking Dynamic Optimization Myths Michael Hind (Material borrowed from 3 hr PLDI 04 Tutorial by Stephen Fink, David Grove, and Michael Hind. See those slides for more details.) September 15, 2004 Future
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationInter-domain Routing
COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationString comparison by transposition networks
String omprison y trnsposition networks Alexnder Tiskin (Joint work with Peter Krushe) Deprtment of Computer Siene University of Wrwik http://www.ds.wrwik..uk/~tiskin (inludes n extended version of this
More information6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page.
6045J/18400J: Automt, Computbility nd Complexity Mrh 30, 2005 Quiz 2: Solutions Prof Nny Lynh Vinod Vikuntnthn Plese write your nme in the upper orner of eh pge Problem Sore 1 2 3 4 5 6 Totl Q2-1 Problem
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationHIGH-LEVEL TRANSFORMATIONS DATA-FLOW MODEL OF COMPUTATION TOKEN FLOW IN A DFG DATA FLOW
1 2 Topis: * Dt-flow grphs * (Non)overlpped sheduling * Miniml itertion period Further reding: * Trnsformtions for speed-up * Trnsformtions for low power Prhi, K.K., High-Level Algorithm nd Arhiteture
More informationOn String Matching in Chunked Texts
On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd
More informationLecture 11: Interactive Rendering Chapters 7 in Advanced GI
Leture 11: Intertive endering Chpters 7 in Advned GI Questions? HW 1 Fll 2004 Kvit Bl Computer Siene Cornell University Intertive Softwre endering Intertive User-driven, not pre-sripted nimtion At lest
More informationMulti-dimensional Selectivity Estimation Using Compressed Histogram Information*
Multi-dimensionl Seletivity Estimtion Using Compressed Histogrm Informtion* Ju-Hong Lee Deo-Hwn Kim Chin-Wn Chung À Deprtment of Informtion nd Communition Engineering À Deprtment of Computer Siene Kore
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationEfficient Runtime Tracking of Allocation Sites in Java
Efficient Runtime Tracking of Allocation Sites in Java Rei Odaira, Kazunori Ogata, Kiyokuni Kawachiya, Tamiya Onodera, Toshio Nakatani IBM Research - Tokyo Why Do You Need Allocation Site Information?
More informationFEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model.
Introutory Eonometris: A Moern Approh 6th Eition Woolrige Test Bnk Solutions Complete ownlo: https://testbnkre.om/ownlo/introutory-eonometris-moern-pproh-6th-eition-jeffreym-woolrige-test-bnk/ Solutions
More informationEncoding techniques for evading n-gram based Intrusion Detection Systems
Encoding techniques for evding n-grm bsed Intrusion Detection Systems Studienrbeit Moritz Bechler moritz.bechler@student.uni-tuebingen.de Universität Tübingen Wilhelm Schickrd Institut SPRING 7 5.7.2012
More informationTree Structured Symmetrical Systems of Linear Equations and their Graphical Solution
Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationMemory-Optimized Software Synthesis from Dataflow Program Graphs withlargesizedatasamples
EURSIP Journl on pplied Signl Processing 2003:6, 54 529 c 2003 Hindwi Publishing orportion Memory-Optimized Softwre Synthesis from tflow Progrm Grphs withlrgesizetsmples Hyunok Oh The School of Electricl
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationMethod-Level Phase Behavior in Java Workloads
Method-Level Phase Behavior in Java Workloads Andy Georges, Dries Buytaert, Lieven Eeckhout and Koen De Bosschere Ghent University Presented by Bruno Dufour dufour@cs.rutgers.edu Rutgers University DCS
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationJazz: A Tool for Demand-Driven Structural Testing
Jazz: A Tool for Demand-Driven Structural Testing J. Misurda, J. A. Clause, J. L. Reed, P. Gandra, B. R. Childers, and M. L. Soffa Department of Computer Science University of Pittsburgh Pittsburgh, Pennsylvania
More informationDesign, Implementation, and Evaluation of a Compilation Server
Design, Implementation, and Evaluation of a Compilation Server Technical Report CU--978-04 HAN B. LEE University of Colorado AMER DIWAN University of Colorado and J. ELIOT B. MOSS University of Massachusetts
More informationFASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE
INTERNATIONAL JOURNAL OF RESEARCH IN COMPUTER APPLICATIONS AND ROBOTICS ISSN 2320-7345 FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE 1 M.JothiLkshmi, M.S., M.Phil. 2 C.Theeendr, M.S., M.Phil. 3 M.K.Pvithr,
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCaches I. CSE 351 Autumn Instructor: Justin Hsia
L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationApproximate computations
Living with floting-point numers Stndrd normlized representtion (sign + frction + exponent): Approximte computtions Rnges of vlues: Representtions for:, +, +0, 0, NN (not numer) Jordi Cortdell Deprtment
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationIncremental Design Debugging in a Logic Synthesis Environment
Inrementl Design Deugging in Logi Synthesis Environment Andres Veneris Jing Brndon Liu University of Toronto Freesle Semiondutors Dept ECE nd CS High Performne Tools Group Toronto, ON M5S 3G4 Austin, TX
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationQubit allocation for quantum circuit compilers
Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationEfficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc
4th Ntionl Conference on Electricl, Electronics nd Computer Engineering (NCEECE 2015) Efficient Regulr Expression Grouping Algorithm Bsed on Lbel Propgtion Xi Chen, Shuqio Chenb nd Ming Moc Ntionl Digitl
More informationChip-Multithreading Systems Need A New Operating Systems Scheduler
Chip-Multithreading Systems Need A New Operating Systems Scheduler Alexandra Fedorova Christopher Small Daniel Nussbaum Margo Seltzer Harvard University, Sun Microsystems Sun Microsystems Sun Microsystems
More informationIt consists of two cold rooms, each with their own evaporator but sharing the same cooling flui d R134a system ( compressor, condenser...).
This system llows study of refrigertion systems implementtion of rmodyn mic clcultions pplied to refrigertion Its uniqueness is tht it is fully controllble vi Internet directly from web browser like Internet
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More information)
Chpter Five /SOLUTIONS Since the speed ws between nd mph during this five minute period, the fuel efficienc during this period is between 5 mpg nd 8 mpg. So the fuel used during this period is between
More information3.5.1 Single slit diffraction
3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke
More informationGraph Theory and DNA Nanostructures. Laura Beaudin, Jo Ellis-Monaghan*, Natasha Jonoska, David Miller, and Greta Pangborn
Grph Theory nd DNA Nnostructures Lur Beudin, Jo Ellis-Monghn*, Ntsh Jonosk, Dvid Miller, nd Gret Pngborn A grph is set of vertices (dots) with edges (lines) connecting them. 1 2 4 6 5 3 A grph F A B C
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More information