Correcting the Dynamic Call Graph Using Control Flow Constraints

Size: px
Start display at page:

Download "Correcting the Dynamic Call Graph Using Control Flow Constraints"

Transcription

1 Correting the Dynmi Cll Grph Using Control Flow Constrints Byeongheol Lee Kevin Resnik Mihel Bond Kthryn MKinley 1 Appered in CC2007

2 Motivtion Complexity of lrge objet oriented progrms Deompose the progrm into smll methods Method boundry beomes performne-bottlenek Dynmi interproedurl optimiztion Solve the method boundry problem Inlining nd speiliztion vry the performne by ftor of 2 Dynmi ll grph (DCG) is ritil input! b w 1 2 w 2 Dynmi ll grph

3 Inurte ll grph 1,000 b ll b ll 500 Error DCG Smple method 3

4 Timer-bsed smpling nd timing bis Cll stk b b b b t 4

5 Timer-bsed smpling nd timing bis Cll stk b b b b t 5

6 Timer-bsed smpling nd timing bis Cll stk b b b b t 6

7 Timer-bsed smpling nd timing bis Cll stk b b b b t 7

8 Timer-bsed smpling nd timing bis timer tik timer tik timer tik timer tik Cll stk b b b b t DCG Smple b b b b 8

9 Overhed nd ury in ll grph profiling 25 Full instrumenttion Overhed (%) Arnold-Grove smpling [2005] Timer-bsed smpling [2000] Aury (%) Corretion [2007] 100

10 Outline Motivtion Cll grph orretion Evlution 10

11 Timing bis in SPEC JVM98 rytre Smpling Normlized frequeny(%) Method lls grouped by soure method 11

12 Timing bis in SPEC JVM98 rytre Normlized frequeny(%) Method lls grouped by soure method 12

13 Corretion lgorithms Detet nd orret DCG error DCG onstrint Stti nd dynmi pprohes New Stti FDOM (Frequeny domintor) orretion Stti pproh Uses stti FDOM onstrint on DCG Dynmi bsi blok profile orretion Dynmi pproh Uses dynmi bsi blok profile onstrint on DCG 13

14 Stti FDOM onstrint FDOM onstrint on CFG ll is exeuted t lest s mny times s ll b ll FDOM ll b FDOM onstrint on DCG f( ) f( b ) ll b ll method 14

15 Stti FDOM orretion FDOM onstrint: f( ) f( b ) 1,000 b Corretion 750 b DCG Smple DCG FDOMCorretion 15 Detet error nd ssign the sme verge frequeny One possible solution to the FDOM onstrint Preserve totl frequeny sum

16 Dynmi bsi blok profile onstrint Some dynmi optimiztion systems do edge profiling Bseline ompiler in Jikes RVM 16 Dynmi bsi blok profile onstrint on CFG f(ll ) = 2 * f(ll b) Dynmi bsi blok profile onstrint on DCG f( ) = 2 * f( ) b method 50% 50% ll b ll

17 Dynmi bsi blok profile orretion Constrint: f( ) = 2* f( b ) 1,000 b Corretion 500 b 500 1,000 DCG Smple DCG EdgeProfileCorretion 17 f New ( b ) = 1/(1+2) * (1, ) = 500 f New ( ) = 2/(1+2) * (1, ) = 1,000

18 18 Best result: rytre 5 Normlized frequeny(%) Normlized frequeny(%) Normlized frequeny(%) Smpling Stti FDOM orretion 0 Dynmi bsi blok profile orretion

19 Outline Motivtion Cll grph orretion Evlution 19

20 Experimentl methodology Jikes RVM on 3.2G Pentium 4 Reply methodology [Blkburn et l. 06] Deterministi run 1 st itertion ompiltion + pplition run 2 nd itertion pplition run Mesurement Aury Use overlp ury [Arnold & Grove 05] Overhed 1 st itertion inludes ll grph orretion Performne 2 nd itertion is pplition-only SPECJVM98 nd DCpo benhmrks 20

21 21 Aury ompress jess Aury(%) rytre db jv mpegudio mtrt jk ntlr blot fop hsqldb jython luindex ipsixql jbb Averge No orretion Stti FDOM orretion Dynmi bsi blok profile orretion

22 22 Overhed ompress jess rytre Normlized exeution time db jv mpegudio mtrt jk ntlr blot fop hsqldb jython luindex ipsixql jbb Averge Stti FDOM Corretion Dynmi bsi blok profile orretion

23 23 Inlining performne Stti FDOM Corretion Dynmi bsi blok Profile orretion Perfet DCG ompress jess rytre db jv mpegudio mtrt jk ntlr blot fop hsqldb jython luindex ipsixql jbb Averge Normlized exeution time Bseline: profile-guided inlining with defult ll grph smpling

24 Summry CFG onstrint improves the DCG Inlining hs been tuned for bd ll grph Advntges Cn be esily ombined with other DCG profiling Miniml overhed only during the ompiltion Future work More inter-proedurl optimiztions with high ury DCG 24

25 Question nd omment Thnk you! 25

26 26

27 27

28 28

29 29

30 Timing bis misleds optimizer 5,000 times 10,000 times b Smpling with timing bis 1,000 smples 500 smples b DCG Perfet DCG Smple 30 DCG Smple Edge frequenies were reversed! Inlining deision Inliner my inline b insted of

31 Cll grph profiling in online optimiztion system Soure progrm e.g. Jv byte ode Compile & instrument Dynmi ll grph Mhine ode Online optimiztion system 31 Profiling nd progrm run t the sme time Minimize profiling overhed Corollry: srifie profiling ury

Minimal Memory Abstractions

Minimal Memory Abstractions Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures

More information

CS453 INTRODUCTION TO DATAFLOW ANALYSIS

CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Demand-Driven Context-Sensitive Alias Analysis for Java

Demand-Driven Context-Sensitive Alias Analysis for Java Demnd-Driven Context-Sensitive Alis Anlysis or Jv Dcong (Tony) Yn Guoqing (Hrry) Xu Atns Rountev Ohio Stte University PRESTO: Progrm Anlyses nd Sotwre Tools Reserch Group, Ohio Stte University Alis Anlysis

More information

Probabilistic Calling Context

Probabilistic Calling Context Probabilistic Calling Context Michael D. Bond Kathryn S. McKinley University of Texas at Austin Why Context Sensitivity? Static program location not enough at com.mckoi.db.jdbcserver.jdbcinterface.execquery():213

More information

Tight triangulations: a link between combinatorics and topology

Tight triangulations: a link between combinatorics and topology Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited

More information

Program Calling Context. Motivation

Program Calling Context. Motivation Program alling ontext Motivation alling context enhances program understanding and dynamic analyses by providing a rich representation of program location ollecting calling context can be expensive The

More information

SOFTWARE-BUG LOCALIZATION WITH GRAPH MINING

SOFTWARE-BUG LOCALIZATION WITH GRAPH MINING Chpter 17 SOFTWARE-BUG LOCALIZATION WITH GRAPH MINING Frnk Eihinger Institute for Progrm Strutures nd Dt Orgniztion (IPD) Universit-t Krlsruhe (TH), Germny eihinger@ipd.uk.de Klemens B-ohm Institute for

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Towards Parallel, Scalable VM Services

Towards Parallel, Scalable VM Services Towards Parallel, Scalable VM Services Kathryn S McKinley The University of Texas at Austin Kathryn McKinley Towards Parallel, Scalable VM Services 1 20 th Century Simplistic Hardware View Faster Processors

More information

Intelligent Compilation

Intelligent Compilation Intelligent Compilation John Cavazos Department of Computer and Information Sciences University of Delaware Autotuning and Compilers Proposition: Autotuning is a component of an Intelligent Compiler. Code

More information

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression

More information

Compiler-Assisted Cache Replacement

Compiler-Assisted Cache Replacement LCPC 3 Formulting The Prolem of Compiler-Assisted Cche Replcement Hongo Yng LCPC 3 Agend Bckground: Memory hierrchy, ISA with cche hints Prolem definition: How should compiler give cche hint to minimize

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved. Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized

More information

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The

More information

CS 268: IP Multicast Routing

CS 268: IP Multicast Routing Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte

More information

Phylogeny and Molecular Evolution

Phylogeny and Molecular Evolution Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion

More information

Adaptive Optimization using Hardware Performance Monitors. Master Thesis by Mathias Payer

Adaptive Optimization using Hardware Performance Monitors. Master Thesis by Mathias Payer Adaptive Optimization using Hardware Performance Monitors Master Thesis by Mathias Payer Supervising Professor: Thomas Gross Supervising Assistant: Florian Schneider Adaptive Optimization using HPM 1/21

More information

SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS

SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS Progress In Eletromgnetis Reserh C, Vol. 3, 195 22, 28 SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS W.-L. Chen nd G.-M. Wng Rdr Engineering Deprtment Missile Institute of Air Fore Engineering

More information

Outline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations

Outline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations CS 412/413 Introduction to Compilers nd Trnsltors Cornell University Andrew Myers Outline Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings

More information

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

Compiling a Parallel DSL to GPU

Compiling a Parallel DSL to GPU Compiling Prllel DSL to GPU Rmesh Nrynswmy Bdri Gopln Synopsys In. Synopsys 2012 1 Agend Overview of Verilog Simultion Prllel Verilog Simultion Algorithms Prllel Simultion Trdeoffs on GPU Chllenges Synopsys

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Triple/Quadruple Patterning Layout Decomposition via Novel Linear Programming and Iterative Rounding

Triple/Quadruple Patterning Layout Decomposition via Novel Linear Programming and Iterative Rounding Triple/Qudruple Ptterning Lyout Deomposition vi Novel Liner Progrmming nd Itertive Rounding Yio Lin, Xioqing Xu, Bei Yu, Ross Bldik nd Dvid Z. Pn ECE Dept., University of Texs t Austin, Austin, TX USA

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

A distributed edit-compile workflow

A distributed edit-compile workflow Time Synhroniztion nd Logil Cloks Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion 3. Logil Time: Lmport Cloks COS 418: Distriuted Systems Leture 4 Kyle Jmieson 2 A distriuted edit-ompile

More information

From Indexing Data Structures to de Bruijn Graphs

From Indexing Data Structures to de Bruijn Graphs From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,

More information

Cone Cluster Labeling for Support Vector Clustering

Cone Cluster Labeling for Support Vector Clustering Cone Cluster Lbeling for Support Vector Clustering Sei-Hyung Lee Deprtment of Computer Science University of Msschusetts Lowell MA 1854, U.S.A. slee@cs.uml.edu Kren M. Dniels Deprtment of Computer Science

More information

Accurate Indirect Branch Prediction

Accurate Indirect Branch Prediction Aurte Indiret Brnh Predition Krel Driesen nd Urs Hölzle Deprtment of Computer Siene University of Cliforni Snt Brbr, CA 9 Abstrt Indiret brnh predition is likely to beome inresingly importnt in the future

More information

II. THE ALGORITHM. A. Depth Map Processing

II. THE ALGORITHM. A. Depth Map Processing Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition

More information

Phase-based Adaptive Recompilation in a JVM

Phase-based Adaptive Recompilation in a JVM Phase-based Adaptive Recompilation in a JVM Dayong Gu Clark Verbrugge Sable Research Group, School of Computer Science McGill University, Montréal, Canada {dgu1, clump}@cs.mcgill.ca April 7, 2008 Sable

More information

How s the Parallel Computing Revolution Going? Towards Parallel, Scalable VM Services

How s the Parallel Computing Revolution Going? Towards Parallel, Scalable VM Services How s the Parallel Computing Revolution Going? Towards Parallel, Scalable VM Services Kathryn S McKinley The University of Texas at Austin Kathryn McKinley Towards Parallel, Scalable VM Services 1 20 th

More information

Java Performance Evaluation through Rigorous Replay Compilation

Java Performance Evaluation through Rigorous Replay Compilation Java Performance Evaluation through Rigorous Replay Compilation Andy Georges Lieven Eeckhout Dries Buytaert Department Electronics and Information Systems, Ghent University, Belgium {ageorges,leeckhou}@elis.ugent.be,

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

Shared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion

Shared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion Tody s Outline Arhitetures Progrmming nd Synhroniztion Disuss pper on Cosmi Cube (messge pssing) Messge pssing review Cosmi Cube disussion > Messge pssing mhine Shred memory model > Communition > Synhroniztion

More information

Outline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers

Outline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers CS 412 Introduction to Compilers Andrew Myers Cornell University Lectur8 Finishing genertion 9 Mr 01 Outline Tiling s syntx-directed trnsltion Implementing function clls Implementing functions Optimizing

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

Debunking Dynamic Optimization Myths

Debunking Dynamic Optimization Myths Debunking Dynamic Optimization Myths Michael Hind (Material borrowed from 3 hr PLDI 04 Tutorial by Stephen Fink, David Grove, and Michael Hind. See those slides for more details.) September 15, 2004 Future

More information

Transparent neutral-element elimination in MPI reduction operations

Transparent neutral-element elimination in MPI reduction operations Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing

More information

Inter-domain Routing

Inter-domain Routing COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

String comparison by transposition networks

String comparison by transposition networks String omprison y trnsposition networks Alexnder Tiskin (Joint work with Peter Krushe) Deprtment of Computer Siene University of Wrwik http://www.ds.wrwik..uk/~tiskin (inludes n extended version of this

More information

6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page.

6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page. 6045J/18400J: Automt, Computbility nd Complexity Mrh 30, 2005 Quiz 2: Solutions Prof Nny Lynh Vinod Vikuntnthn Plese write your nme in the upper orner of eh pge Problem Sore 1 2 3 4 5 6 Totl Q2-1 Problem

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

HIGH-LEVEL TRANSFORMATIONS DATA-FLOW MODEL OF COMPUTATION TOKEN FLOW IN A DFG DATA FLOW

HIGH-LEVEL TRANSFORMATIONS DATA-FLOW MODEL OF COMPUTATION TOKEN FLOW IN A DFG DATA FLOW 1 2 Topis: * Dt-flow grphs * (Non)overlpped sheduling * Miniml itertion period Further reding: * Trnsformtions for speed-up * Trnsformtions for low power Prhi, K.K., High-Level Algorithm nd Arhiteture

More information

On String Matching in Chunked Texts

On String Matching in Chunked Texts On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd

More information

Lecture 11: Interactive Rendering Chapters 7 in Advanced GI

Lecture 11: Interactive Rendering Chapters 7 in Advanced GI Leture 11: Intertive endering Chpters 7 in Advned GI Questions? HW 1 Fll 2004 Kvit Bl Computer Siene Cornell University Intertive Softwre endering Intertive User-driven, not pre-sripted nimtion At lest

More information

Multi-dimensional Selectivity Estimation Using Compressed Histogram Information*

Multi-dimensional Selectivity Estimation Using Compressed Histogram Information* Multi-dimensionl Seletivity Estimtion Using Compressed Histogrm Informtion* Ju-Hong Lee Deo-Hwn Kim Chin-Wn Chung À Deprtment of Informtion nd Communition Engineering À Deprtment of Computer Siene Kore

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Efficient Runtime Tracking of Allocation Sites in Java

Efficient Runtime Tracking of Allocation Sites in Java Efficient Runtime Tracking of Allocation Sites in Java Rei Odaira, Kazunori Ogata, Kiyokuni Kawachiya, Tamiya Onodera, Toshio Nakatani IBM Research - Tokyo Why Do You Need Allocation Site Information?

More information

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model.

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model. Introutory Eonometris: A Moern Approh 6th Eition Woolrige Test Bnk Solutions Complete ownlo: https://testbnkre.om/ownlo/introutory-eonometris-moern-pproh-6th-eition-jeffreym-woolrige-test-bnk/ Solutions

More information

Encoding techniques for evading n-gram based Intrusion Detection Systems

Encoding techniques for evading n-gram based Intrusion Detection Systems Encoding techniques for evding n-grm bsed Intrusion Detection Systems Studienrbeit Moritz Bechler moritz.bechler@student.uni-tuebingen.de Universität Tübingen Wilhelm Schickrd Institut SPRING 7 5.7.2012

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Memory-Optimized Software Synthesis from Dataflow Program Graphs withlargesizedatasamples

Memory-Optimized Software Synthesis from Dataflow Program Graphs withlargesizedatasamples EURSIP Journl on pplied Signl Processing 2003:6, 54 529 c 2003 Hindwi Publishing orportion Memory-Optimized Softwre Synthesis from tflow Progrm Grphs withlrgesizetsmples Hyunok Oh The School of Electricl

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

Method-Level Phase Behavior in Java Workloads

Method-Level Phase Behavior in Java Workloads Method-Level Phase Behavior in Java Workloads Andy Georges, Dries Buytaert, Lieven Eeckhout and Koen De Bosschere Ghent University Presented by Bruno Dufour dufour@cs.rutgers.edu Rutgers University DCS

More information

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

Jazz: A Tool for Demand-Driven Structural Testing

Jazz: A Tool for Demand-Driven Structural Testing Jazz: A Tool for Demand-Driven Structural Testing J. Misurda, J. A. Clause, J. L. Reed, P. Gandra, B. R. Childers, and M. L. Soffa Department of Computer Science University of Pittsburgh Pittsburgh, Pennsylvania

More information

Design, Implementation, and Evaluation of a Compilation Server

Design, Implementation, and Evaluation of a Compilation Server Design, Implementation, and Evaluation of a Compilation Server Technical Report CU--978-04 HAN B. LEE University of Colorado AMER DIWAN University of Colorado and J. ELIOT B. MOSS University of Massachusetts

More information

FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE

FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE INTERNATIONAL JOURNAL OF RESEARCH IN COMPUTER APPLICATIONS AND ROBOTICS ISSN 2320-7345 FASTEST METHOD TO FIND ALTERNATIVE RE-ROUTE 1 M.JothiLkshmi, M.S., M.Phil. 2 C.Theeendr, M.S., M.Phil. 3 M.K.Pvithr,

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Caches I. CSE 351 Autumn Instructor: Justin Hsia

Caches I. CSE 351 Autumn Instructor: Justin Hsia L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Approximate computations

Approximate computations Living with floting-point numers Stndrd normlized representtion (sign + frction + exponent): Approximte computtions Rnges of vlues: Representtions for:, +, +0, 0, NN (not numer) Jordi Cortdell Deprtment

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

Incremental Design Debugging in a Logic Synthesis Environment

Incremental Design Debugging in a Logic Synthesis Environment Inrementl Design Deugging in Logi Synthesis Environment Andres Veneris Jing Brndon Liu University of Toronto Freesle Semiondutors Dept ECE nd CS High Performne Tools Group Toronto, ON M5S 3G4 Austin, TX

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Qubit allocation for quantum circuit compilers

Qubit allocation for quantum circuit compilers Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Efficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc

Efficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc 4th Ntionl Conference on Electricl, Electronics nd Computer Engineering (NCEECE 2015) Efficient Regulr Expression Grouping Algorithm Bsed on Lbel Propgtion Xi Chen, Shuqio Chenb nd Ming Moc Ntionl Digitl

More information

Chip-Multithreading Systems Need A New Operating Systems Scheduler

Chip-Multithreading Systems Need A New Operating Systems Scheduler Chip-Multithreading Systems Need A New Operating Systems Scheduler Alexandra Fedorova Christopher Small Daniel Nussbaum Margo Seltzer Harvard University, Sun Microsystems Sun Microsystems Sun Microsystems

More information

It consists of two cold rooms, each with their own evaporator but sharing the same cooling flui d R134a system ( compressor, condenser...).

It consists of two cold rooms, each with their own evaporator but sharing the same cooling flui d R134a system ( compressor, condenser...). This system llows study of refrigertion systems implementtion of rmodyn mic clcultions pplied to refrigertion Its uniqueness is tht it is fully controllble vi Internet directly from web browser like Internet

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

)

) Chpter Five /SOLUTIONS Since the speed ws between nd mph during this five minute period, the fuel efficienc during this period is between 5 mpg nd 8 mpg. So the fuel used during this period is between

More information

3.5.1 Single slit diffraction

3.5.1 Single slit diffraction 3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke

More information

Graph Theory and DNA Nanostructures. Laura Beaudin, Jo Ellis-Monaghan*, Natasha Jonoska, David Miller, and Greta Pangborn

Graph Theory and DNA Nanostructures. Laura Beaudin, Jo Ellis-Monaghan*, Natasha Jonoska, David Miller, and Greta Pangborn Grph Theory nd DNA Nnostructures Lur Beudin, Jo Ellis-Monghn*, Ntsh Jonosk, Dvid Miller, nd Gret Pngborn A grph is set of vertices (dots) with edges (lines) connecting them. 1 2 4 6 5 3 A grph F A B C

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information