Greedy Algorithm. Algorithm Fall Semester
|
|
- Benjamin Banks
- 6 years ago
- Views:
Transcription
1 Greey Algorithm Algorithm 0 Fll Semester
2 Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion prolems A greey lgorithm works in phses. At eh phse: You tke the est you n get right now, without regr for future onsequenes You hope tht y hoosing lol optimum t eh step, you will en up t glol optimum /
3 Exmple: Counting money Suppose you wnt to ount out ertin mount of money, using the fewest possile ills n oins A greey lgorithm woul o this woul e: At eh step, tke the lrgest possile ill or oin tht oes not overshoot Exmple: To mke $.9, you n hoose: $5 ill $ ill, to mke $ 5 oin, to mke $.5 A 0 oin, to mke $.5 four oins, to mke $.9 For US money, the greey lgorithm lwys gives the optimum solution /
4 A filure of the greey lgorithm In some (fitionl) monetry system, krons ome in kron, 7 kron, n 0 kron oins Using greey lgorithm to ount out 5 krons, you woul get A 0 kron piee Five kron piees, for totl of 5 krons This requires six oins A etter solution woul e to use two 7 kron piees n one kron piee This only requires three oins The greey lgorithm results in solution, ut not in n optiml solution /
5 Exmple : Mking hnges 5 /
6 Huffmn oes Any inry tree with eges lele with 0 s n s yiels prefixfree oe of hrters ssigne to its leves Optiml inry tree minimizing the expete (weighte verge) length of oewor n e onstrute s follows Huffmn s lgorithm Initilize n one-noe trees with lphet hrters n the tree weights with their frequenies. Repet the following step n- times: join two inry trees with smllest weights into one (s left n right sutrees) n mke its weight equl the sum of the weights of the two trees. Mrk eges leing to left n right sutrees with 0 s n s, respetively. /
7 Huffmn enoing The Huffmn enoing lgorithm is greey lgorithm You lwys pik the two smllest numers to omine A B C D E F A=00 B=00 C=0 D=00 E= F=0 7 /
8 B _ C D A Exmple 0. C 0. D A hrter A B C D _ frequeny B _ A B _ C D oewor Enoe the text ADCB : C 0. D 0. B _ 0.5 A.0 Deoe the text whose enoing is : CDB_ACD C D A 0. B 0.5 _ 8 /
9 In-Clss Exerise Buil huffmn tree for the following: A x ={,,,, e } P x ={0.5, 0.5, 0., 0.5, 0.5} Define the oewor for eh lphet. Enoe the text - e 9 /
10 Minimum spnning tree A minimum spnning tree is lest-ost suset of the eges of grph tht onnets ll the noes Strt y piking ny noe n ing it to the tree Repetely: Pik ny lest-ost ege from noe in the tree to noe not in the tree, n the ege n new noe to the tree Stop when ll noes hve een e to the tree 5 The result is lest-ost (++++=) spnning tree If you think some other ege shoul e in the spnning tree: Try ing tht ege Note tht the ege is prt of yle To rek the yle, you must remove the ege with the gretest ost This will e the ege you just e 0 /
11 Trveling slesmn A slesmn must visit every ity (strting from ity A), n wnts to over the lest possile istne He n revisit ity (n reuse ro) if neessry He oes this y using greey lgorithm: He goes to the next nerest ity from wherever he is A B C D E From A he goes to B From B he goes to D This is not going to result in shortest pth! The est result he n get now will e ABDBCE, t ost of An tul lest-ost pth from A is ADBCE, t ost of /
12 Other greey lgorithms Dijkstr s lgorithm for fining the shortest pth in grph Alwys tkes the shortest ege onneting known noe to n unknown noe Prim s lgorithm for fining minimum-ost spnning tree Alwys tkes the lowest-ost ege etween noes in the spnning tree n noes not yet in the spnning tree Kruskl s lgorithm for fining minimum-ost spnning tree Alwys tries the lowest-ost remining ege /
13 Dijkstr : Exmple 7 5 e Tree verties (-,0) Remining verties (,) (-, ) (,7) e(-, ) 5 7 e (,) (,+) (,+) e(-, ) 5 7 e (,5) (,7) e(,5+) 5 7 e (,7) e(,9) e(,9) 5 7 e
14 In-Clss Exerise Apply Dijkstr s lgorithm to fin the shortest pth in the following grph. /
15 Kruskl s MST - Exmple 5 /
16 Prim s MST - Exmple /
17 In-Clss Exerise Fin minimum-ost spnning tree Kruskl Prim 7 /
18 Conneting wires There re n white ots n n lk ots, eqully spe, in line You wnt to onnet eh white ot with some one lk ot, with minimum totl length of wire Exmple: Totl wire length ove is = 8 Do you see greey lgorithm for oing this? Does the lgorithm gurntee n optiml solution? Cn you prove it? Cn you fin ounterexmple? 8 /
19 A sheuling prolem You hve to run nine jos, with running times of, 5,, 0,,, 5, 8, n 0 minutes You hve three proessors on whih you n run these jos You eie to o the longest-running jos first, on whtever proessor is ville P 0 0 P P Time to ompletion: = 5 minutes This solution isn t, ut we might e le to o etter 9 /
20 Another pproh Wht woul e the result if you rn the shortest jo first? Agin, the running times re, 5,, 0,,, 5, 8, n 0 minutes P 0 5 P P Tht wsn t suh goo ie; time to ompletion is now = 0 minutes Note, however, tht the greey lgorithm itself is fst All we h to o t eh stge ws pik the minimum or mximum 0 /
21 An optimum solution Better solutions o exist: P 0 P P /
22 Tsk Sheuling Given: set T of n tsks, eh hving: A strt time, s i A finish time, f i (where s i < f i ) Gol: Perform ll the tsks using minimum numer of mhines. Mhine Mhine Mhine /
23 Exmple Given: set T of n tsks, eh hving: A strt time, s i A finish time, f i (where s i < f i ) [,], [,], [,5], [,7], [,7], [,9], [7,8] (orere y strt) Gol: Perform ll tsks on min. numer of mhines /
24 Q & A
Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More informationV = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)
Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationMITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam
Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationDistance vector protocol
istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers
More informationGraph theory Route problems
Bhelors thesis Grph theory Route prolems Author: Aolphe Nikwigize Dte: 986 - -5 Sujet: Mthemtis Level: First level (Bhelor) Course oe: MAE Astrt In this thesis we will review some route prolems whih re
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationOutline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals
Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCalculus Differentiation
//007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More information1 Disjoint-set data structure.
CS 124 Setion #4 Union-Fin, Greey Algorithms 2/20/17 1 Disjoint-set ata struture. 1.1 Operations Disjoint-set ata struture enale us to effiiently perform operations suh as plaing elements into sets, querying
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationLecture 13: Graphs I: Breadth First Search
Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationCOMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.
COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationMinimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationIntroduction. Example
OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationCOMP108 Algorithmic Foundations
Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationInternet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More information12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler
CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt
More informationWORKSHOP 9 HEX MESH USING SWEEP VECTOR
WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1 WS9-2 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationGraph Contraction and Connectivity
Chpter 14 Grph Contrtion n Connetivity So fr we hve mostly overe tehniques for solving problems on grphs tht were evelope in the ontext of sequentil lgorithms. Some of them re esy to prllelize while others
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationUTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS
UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCan Pythagoras Swim?
Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationFinal Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book
inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationOutline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP
ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationTyping with Weird Keyboards Notes
Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next
More informationInternet Routing. Reminder: Routing. CPSC Network Programming
PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationClass Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414
Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More information3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull
Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron
More informationAdvanced Programming Handout 5. Enter Okasaki. Persistent vs. Ephemeral. Functional Queues. Simple Example. Persistent vs.
Avne Progrmming Hnout 5 Purel Funtionl Dt Strutures: A Cse Stu in Funtionl Progrmming Persistent vs. Ephemerl An ephemerl t struture is one for whih onl one version is ville t time: fter n upte opertion,
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationError Numbers of the Standard Function Block
A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationLecture 12 : Topological Spaces
Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationSection 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that
Setion 2.3 Funtions Definition: Let n e sets. funtion (mpping, mp) f from to, enote f :, is suset of suh tht x[x y[y < x, y > f ]] n [< x, y 1 > f < x, y 2 > f ] y 1 = y 2 Note: f ssoites with eh x in
More informationDuality in linear interval equations
Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny
More informationGreedy Algorithms Spanning Trees
Greedy Algoritms Spnning Trees Cpter 1, Wt mkes greedy lgoritm? Fesible Hs to stisfy te problem s constrints Loclly Optiml Te greedy prt Hs to mke te best locl coice mong ll fesible coices vilble on tt
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationOutline. Graphs Describing Precedence. Graphs Describing Precedence. Topological SorFng of DAGs. Graphs Describing Precedence 4/25/12. Part 10.
4// Outlin Prt. Grphs CS Algorithms n Dt Struturs Introution Trminology Implmnting Grphs Grph Trvrsls Topologil Sorting Shortst Pths Spnning Trs Minimum Spnning Trs Ciruits Grphs Dsriing Prn Grphs Dsriing
More informationChapter 4 Fuzzy Graph and Relation
Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationA distributed edit-compile workflow
Time Synhroniztion nd Logil Cloks Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion 3. Logil Time: Lmport Cloks COS 418: Distriuted Systems Leture 4 Kyle Jmieson 2 A distriuted edit-ompile
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationUninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012
1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt
More informationProblem Final Exam Set 2 Solutions
CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does
More information5 ANGLES AND POLYGONS
5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.
More informationWidth and Bounding Box of Imprecise Points
Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationCSc 453 Compilers and Systems Software. 6 : Top-Down Parsing I
C 45 Compilers n ystems oftwre 6 : op-down Prsing I Christin Collberg Deprtment of Computer iene University of rizon ollberg@gmil.om Copyright 2009 Christin Collberg eptember 14, 2009 1 Overview 2 Compiler
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More information