Greedy Algorithm. Algorithm Fall Semester

Size: px
Start display at page:

Download "Greedy Algorithm. Algorithm Fall Semester"

Transcription

1 Greey Algorithm Algorithm 0 Fll Semester

2 Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion prolems A greey lgorithm works in phses. At eh phse: You tke the est you n get right now, without regr for future onsequenes You hope tht y hoosing lol optimum t eh step, you will en up t glol optimum /

3 Exmple: Counting money Suppose you wnt to ount out ertin mount of money, using the fewest possile ills n oins A greey lgorithm woul o this woul e: At eh step, tke the lrgest possile ill or oin tht oes not overshoot Exmple: To mke $.9, you n hoose: $5 ill $ ill, to mke $ 5 oin, to mke $.5 A 0 oin, to mke $.5 four oins, to mke $.9 For US money, the greey lgorithm lwys gives the optimum solution /

4 A filure of the greey lgorithm In some (fitionl) monetry system, krons ome in kron, 7 kron, n 0 kron oins Using greey lgorithm to ount out 5 krons, you woul get A 0 kron piee Five kron piees, for totl of 5 krons This requires six oins A etter solution woul e to use two 7 kron piees n one kron piee This only requires three oins The greey lgorithm results in solution, ut not in n optiml solution /

5 Exmple : Mking hnges 5 /

6 Huffmn oes Any inry tree with eges lele with 0 s n s yiels prefixfree oe of hrters ssigne to its leves Optiml inry tree minimizing the expete (weighte verge) length of oewor n e onstrute s follows Huffmn s lgorithm Initilize n one-noe trees with lphet hrters n the tree weights with their frequenies. Repet the following step n- times: join two inry trees with smllest weights into one (s left n right sutrees) n mke its weight equl the sum of the weights of the two trees. Mrk eges leing to left n right sutrees with 0 s n s, respetively. /

7 Huffmn enoing The Huffmn enoing lgorithm is greey lgorithm You lwys pik the two smllest numers to omine A B C D E F A=00 B=00 C=0 D=00 E= F=0 7 /

8 B _ C D A Exmple 0. C 0. D A hrter A B C D _ frequeny B _ A B _ C D oewor Enoe the text ADCB : C 0. D 0. B _ 0.5 A.0 Deoe the text whose enoing is : CDB_ACD C D A 0. B 0.5 _ 8 /

9 In-Clss Exerise Buil huffmn tree for the following: A x ={,,,, e } P x ={0.5, 0.5, 0., 0.5, 0.5} Define the oewor for eh lphet. Enoe the text - e 9 /

10 Minimum spnning tree A minimum spnning tree is lest-ost suset of the eges of grph tht onnets ll the noes Strt y piking ny noe n ing it to the tree Repetely: Pik ny lest-ost ege from noe in the tree to noe not in the tree, n the ege n new noe to the tree Stop when ll noes hve een e to the tree 5 The result is lest-ost (++++=) spnning tree If you think some other ege shoul e in the spnning tree: Try ing tht ege Note tht the ege is prt of yle To rek the yle, you must remove the ege with the gretest ost This will e the ege you just e 0 /

11 Trveling slesmn A slesmn must visit every ity (strting from ity A), n wnts to over the lest possile istne He n revisit ity (n reuse ro) if neessry He oes this y using greey lgorithm: He goes to the next nerest ity from wherever he is A B C D E From A he goes to B From B he goes to D This is not going to result in shortest pth! The est result he n get now will e ABDBCE, t ost of An tul lest-ost pth from A is ADBCE, t ost of /

12 Other greey lgorithms Dijkstr s lgorithm for fining the shortest pth in grph Alwys tkes the shortest ege onneting known noe to n unknown noe Prim s lgorithm for fining minimum-ost spnning tree Alwys tkes the lowest-ost ege etween noes in the spnning tree n noes not yet in the spnning tree Kruskl s lgorithm for fining minimum-ost spnning tree Alwys tries the lowest-ost remining ege /

13 Dijkstr : Exmple 7 5 e Tree verties (-,0) Remining verties (,) (-, ) (,7) e(-, ) 5 7 e (,) (,+) (,+) e(-, ) 5 7 e (,5) (,7) e(,5+) 5 7 e (,7) e(,9) e(,9) 5 7 e

14 In-Clss Exerise Apply Dijkstr s lgorithm to fin the shortest pth in the following grph. /

15 Kruskl s MST - Exmple 5 /

16 Prim s MST - Exmple /

17 In-Clss Exerise Fin minimum-ost spnning tree Kruskl Prim 7 /

18 Conneting wires There re n white ots n n lk ots, eqully spe, in line You wnt to onnet eh white ot with some one lk ot, with minimum totl length of wire Exmple: Totl wire length ove is = 8 Do you see greey lgorithm for oing this? Does the lgorithm gurntee n optiml solution? Cn you prove it? Cn you fin ounterexmple? 8 /

19 A sheuling prolem You hve to run nine jos, with running times of, 5,, 0,,, 5, 8, n 0 minutes You hve three proessors on whih you n run these jos You eie to o the longest-running jos first, on whtever proessor is ville P 0 0 P P Time to ompletion: = 5 minutes This solution isn t, ut we might e le to o etter 9 /

20 Another pproh Wht woul e the result if you rn the shortest jo first? Agin, the running times re, 5,, 0,,, 5, 8, n 0 minutes P 0 5 P P Tht wsn t suh goo ie; time to ompletion is now = 0 minutes Note, however, tht the greey lgorithm itself is fst All we h to o t eh stge ws pik the minimum or mximum 0 /

21 An optimum solution Better solutions o exist: P 0 P P /

22 Tsk Sheuling Given: set T of n tsks, eh hving: A strt time, s i A finish time, f i (where s i < f i ) Gol: Perform ll the tsks using minimum numer of mhines. Mhine Mhine Mhine /

23 Exmple Given: set T of n tsks, eh hving: A strt time, s i A finish time, f i (where s i < f i ) [,], [,], [,5], [,7], [,7], [,9], [7,8] (orere y strt) Gol: Perform ll tsks on min. numer of mhines /

24 Q & A

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

Graph theory Route problems

Graph theory Route problems Bhelors thesis Grph theory Route prolems Author: Aolphe Nikwigize Dte: 986 - -5 Sujet: Mthemtis Level: First level (Bhelor) Course oe: MAE Astrt In this thesis we will review some route prolems whih re

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

1 Disjoint-set data structure.

1 Disjoint-set data structure. CS 124 Setion #4 Union-Fin, Greey Algorithms 2/20/17 1 Disjoint-set ata struture. 1.1 Operations Disjoint-set ata struture enale us to effiiently perform operations suh as plaing elements into sets, querying

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Lecture 13: Graphs I: Breadth First Search

Lecture 13: Graphs I: Breadth First Search Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator. COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Minimal Memory Abstractions

Minimal Memory Abstractions Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Introduction. Example

Introduction. Example OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

Graphs with at most two trees in a forest building process

Graphs with at most two trees in a forest building process Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,

More information

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt

More information

WORKSHOP 9 HEX MESH USING SWEEP VECTOR

WORKSHOP 9 HEX MESH USING SWEEP VECTOR WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1 WS9-2 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Graph Contraction and Connectivity

Graph Contraction and Connectivity Chpter 14 Grph Contrtion n Connetivity So fr we hve mostly overe tehniques for solving problems on grphs tht were evelope in the ontext of sequentil lgorithms. Some of them re esy to prllelize while others

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Can Pythagoras Swim?

Can Pythagoras Swim? Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify

More information

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

Internet Routing. Reminder: Routing. CPSC Network Programming

Internet Routing. Reminder: Routing. CPSC Network Programming PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414 Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron

More information

Advanced Programming Handout 5. Enter Okasaki. Persistent vs. Ephemeral. Functional Queues. Simple Example. Persistent vs.

Advanced Programming Handout 5. Enter Okasaki. Persistent vs. Ephemeral. Functional Queues. Simple Example. Persistent vs. Avne Progrmming Hnout 5 Purel Funtionl Dt Strutures: A Cse Stu in Funtionl Progrmming Persistent vs. Ephemerl An ephemerl t struture is one for whih onl one version is ville t time: fter n upte opertion,

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Error Numbers of the Standard Function Block

Error Numbers of the Standard Function Block A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

Lecture 12 : Topological Spaces

Lecture 12 : Topological Spaces Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that Setion 2.3 Funtions Definition: Let n e sets. funtion (mpping, mp) f from to, enote f :, is suset of suh tht x[x y[y < x, y > f ]] n [< x, y 1 > f < x, y 2 > f ] y 1 = y 2 Note: f ssoites with eh x in

More information

Duality in linear interval equations

Duality in linear interval equations Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny

More information

Greedy Algorithms Spanning Trees

Greedy Algorithms Spanning Trees Greedy Algoritms Spnning Trees Cpter 1, Wt mkes greedy lgoritm? Fesible Hs to stisfy te problem s constrints Loclly Optiml Te greedy prt Hs to mke te best locl coice mong ll fesible coices vilble on tt

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1 Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition

More information

Outline. Graphs Describing Precedence. Graphs Describing Precedence. Topological SorFng of DAGs. Graphs Describing Precedence 4/25/12. Part 10.

Outline. Graphs Describing Precedence. Graphs Describing Precedence. Topological SorFng of DAGs. Graphs Describing Precedence 4/25/12. Part 10. 4// Outlin Prt. Grphs CS Algorithms n Dt Struturs Introution Trminology Implmnting Grphs Grph Trvrsls Topologil Sorting Shortst Pths Spnning Trs Minimum Spnning Trs Ciruits Grphs Dsriing Prn Grphs Dsriing

More information

Chapter 4 Fuzzy Graph and Relation

Chapter 4 Fuzzy Graph and Relation Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

A distributed edit-compile workflow

A distributed edit-compile workflow Time Synhroniztion nd Logil Cloks Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion 3. Logil Time: Lmport Cloks COS 418: Distriuted Systems Leture 4 Kyle Jmieson 2 A distriuted edit-ompile

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012 1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt

More information

Problem Final Exam Set 2 Solutions

Problem Final Exam Set 2 Solutions CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does

More information

5 ANGLES AND POLYGONS

5 ANGLES AND POLYGONS 5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.

More information

Width and Bounding Box of Imprecise Points

Width and Bounding Box of Imprecise Points Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its

More information

A dual of the rectangle-segmentation problem for binary matrices

A dual of the rectangle-segmentation problem for binary matrices A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

CSc 453 Compilers and Systems Software. 6 : Top-Down Parsing I

CSc 453 Compilers and Systems Software. 6 : Top-Down Parsing I C 45 Compilers n ystems oftwre 6 : op-down Prsing I Christin Collberg Deprtment of Computer iene University of rizon ollberg@gmil.om Copyright 2009 Christin Collberg eptember 14, 2009 1 Overview 2 Compiler

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information