Orthogonal line segment intersection

Size: px
Start display at page:

Download "Orthogonal line segment intersection"

Transcription

1 Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl line segments Generl cse nd Bentley-Otmn line sweep lgorithm Lur Tom Bowdoin College Lur Tom Bowdoin College Line segment intersection Line segment intersection Line segment intersection Prolem: Given set of line segments in 2D, find ll their pirwise intersections. Prolem: Given set of line segments in 2D, find ll their pirwise intersections. Prolem: Given set of line segments in 2D, find ll their pirwise intersections

2 Applictions Applictions Applictions Grphics: rendering => hidden surfces ==> intersections Motion plnning nd collision detection in utonomous systems/rootics Geogrphicl dt: River networks, rod networks, rilwys,.. R Applictions Applictions Applictions Geogrphicl dt: River networks, rod networks, rilwys,.. Mp overly in GIS Mp overly in GIS from: from: 12

3 Nive Nottion n: size of the input (numer of segments) k: size of output (numer of intersections) A specil cse: Prolem: Given set of n line segments in 2D, find ll their pirwise intersections. Algorithms Exercises: Give upper nd lower ounds for k, drw exmples tht chieve these ounds. Give strightforwrd lgorithm tht computes ll intersections nd nlyze its running time. Give scenrios when this lgorithm is efficient/inefficient. Wht is your intuition of n upper ound for this prolem? (how fst would you hope to e le to solve it?) Exercises Come up with strightforwrd lgorithm nd nlyze its time Improved lgorithm? Blnced Binry Serch Trees - review - Binry Serch Trees (BST) Opertions insert delete serch successor, predecessor trversls (in order,..) min, mx Blnced Binry Serch Trees (BBST) Binry serch trees + invrints tht constrin the tree to e lnced (nd thus hve logrithmic height) These invrints hve to e mintined when inserting nd deleting (so we cn think of the tree s self-lncing) BBST vrints red-lck trees AVL trees B-trees (,) trees

4 Exmple: Red-Blck trees Exmple: Red-Blck trees Exmple: Red-Blck trees Binry serch tree, nd Ech node is Red or Blck The children of Red node must e Blck The numer of Blck nodes on ny pth from the root to ny node tht does not hve two children must e the sme Theorem: A Red-Blck tree of n nodes hs height Thet( lg n). Theorem: After n insertion or deletion, the RB tree invrints cn e mintined in dditionl O(lg n) time. This is done y performing rottions nd recoloring nodes on the pth from the inserted/deleted node to the root. Note: esier to conceptulize the tree s contining explicit NULL leves, ll Blck the numer of Blck nodes on ny root-to-lef pth must e the sme Binry Serch Trees Opertions insert delete serch successor, predecessor trversls (in order,..) min, mx rnge serch (1D) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,)

5 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) If P is sttic If P is sttic If P is sttic Ides? Pre-precess: sort If P is dynmic: Rnge serch: inry serch, O( lg n + k) per query use BBST D rnge serching with Binry Serch Trees 1D rnge serching with Binry Serch Trees 1D rnge serching with Binry Serch Trees Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51, 52 Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51, 52 Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51,

6 1D rnge serching with Binry Serch Trees 1D Rnge Serching with Red-Blck Trees 1D rnge serching with Binry Serch Trees Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51, 52 Exmple: rnge_serch(10, 16): return 11, 13, 15 Rnge serch (,): return ll elements in this intervl D rnge serching with Binry Serch Trees Rnge serch (,): return ll elements in this intervl Cn e nswered in O( lg n+k), where k = O(n) is the size of output

7 solve the prolem ehind the line solve the prolem ehind the line //the events //our events //our events Sort X nd trverse the events in order Sort X nd trverse the events in order xstrt xend x solve the prolem ehind the line solve the prolem ehind the line solve the prolem ehind the line //our events //our events //our events Sort X nd trverse the events in order Sort X nd trverse the events in order Sort X nd trverse the events in order

8 solve the prolem ehind the line Events Line sweep technique Trverse events in order nd mintin n Active Structure (AS) AS contins ojects tht re ctive (strted ut not ended) in other words they re intersected y the present sweep line t certin events, insert in AS Events eginning of horizontl segment end of horizontl segment Events eginning of horizontl segment end of horizontl segment t certin events, delete from AS t other events, query AS verticl segment verticl segment

9

10 Line sweep Pick n exmple nd simulte the lgorithm How do you implement the AS? Anlysis? Frequently used technique Line cn e horizontl or verticl or rdil or. Trverse events in order nd mintin n Active Structure (AS) AS mintins ojects tht re ctive (strted ut not ended) in other words they re intersected y the present sweep line t certin events, insert in AS t certin events, delete from AS t other events, query AS 58 59

Orthogonal line segment intersection. Computational Geometry [csci 3250] Laura Toma Bowdoin College

Orthogonal line segment intersection. Computational Geometry [csci 3250] Laura Toma Bowdoin College Orthogonal line segment intersection Computational Geometry [csci 3250] Laura Toma Bowdoin College Line segment intersection The problem (what) Applications (why) Algorithms (how) A special case: Orthogonal

More information

Line segment intersection (I): Orthogonal line segment intersection. Computational Geometry [csci 3250] Laura Toma Bowdoin College

Line segment intersection (I): Orthogonal line segment intersection. Computational Geometry [csci 3250] Laura Toma Bowdoin College Line segment intersection (I): Orthogonal line segment intersection Computational Geometry [csci 3250] Laura Toma Bowdoin College Outline The problem (what) Applications (why) Algorithms (how) A special

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

ITEC2620 Introduction to Data Structures

ITEC2620 Introduction to Data Structures ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Deletion The Two Child Case 10 Delete(5) Deletion The Two Child Case. Balanced BST. Finally

Deletion The Two Child Case 10 Delete(5) Deletion The Two Child Case. Balanced BST. Finally Deletion Te Two Cild Cse Delete() Deletion Te Two Cild Cse Ide: Replce te deleted node wit vlue gurnteed to e etween te two cild sutrees! Options: succ from rigt sutree: findmin(t.rigt) pred from left

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

2-3 search trees red-black BSTs B-trees

2-3 search trees red-black BSTs B-trees 2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

CS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014.

CS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014. 1 CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces!! Prof. Jmes O Brien University of Cliforni, Berkeley! V2013F101.0 Tody 2 Clipping Clipping to view volume Clipping ritrry polygons Hidden

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

CS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons

CS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces Prof. Jmes O Brien University of Cliforni, Berkeley V2008S101.0 1 Tody Clipping Clipping to view volume Clipping ritrry polygons Hidden Surfce

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E

4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E 4-1 NAME DATE PERIOD Pges 142 147 Prllel Lines nd Plnes When plnes do not intersect, they re sid to e prllel. Also, when lines in the sme plne do not intersect, they re prllel. But when lines re not in

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

Phylogeny and Molecular Evolution

Phylogeny and Molecular Evolution Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Applications of the Definite Integral ( Areas and Volumes)

Applications of the Definite Integral ( Areas and Volumes) Mth1242 Project II Nme: Applictions of the Definite Integrl ( Ares nd Volumes) In this project, we explore some pplictions of the definite integrl. We use integrls to find the re etween the grphs of two

More information

Lecture 10: Suffix Trees

Lecture 10: Suffix Trees Computtionl Genomics Prof. Ron Shmir, Prof. Him Wolfson, Dr. Irit Gt-Viks School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' רון שמיר, פרופ' חיים וולפסון, דר' עירית גת-ויקס ביה"ס למדעי

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

8.2 Areas in the Plane

8.2 Areas in the Plane 39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to

More information

B. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a

B. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a Mth 176 Clculus Sec. 6.: Volume I. Volume By Slicing A. Introduction We will e trying to find the volume of solid shped using the sum of cross section res times width. We will e driving towrd developing

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy /9/8 Fioncci (Leonrdo Pisno) -? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS Spring 8 Fioncci function fi() fi() fi(n) fi(n-) + fi(n-) for n,,,,,, 8,,, In his ook in titled Lier

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Approximate computations

Approximate computations Living with floting-point numers Stndrd normlized representtion (sign + frction + exponent): Approximte computtions Rnges of vlues: Representtions for:, +, +0, 0, NN (not numer) Jordi Cortdell Deprtment

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

x )Scales are the reciprocal of each other. e

x )Scales are the reciprocal of each other. e 9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

A dual of the rectangle-segmentation problem for binary matrices

A dual of the rectangle-segmentation problem for binary matrices A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Lesson 11 MA Nick Egbert

Lesson 11 MA Nick Egbert Lesson MA 62 Nick Eert Overview In this lesson we return to stndrd Clculus II mteril with res etween curves. Recll rom irst semester clculus tht the deinite interl hd eometric menin, nmel the re under

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

Lecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI)

Lecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI) Computer Grphics (CS 4731) Lecture 7: Building 3D Models (Prt 1) Prof Emmnuel Agu Computer Science Dept. Worcester Polytechnic Institute (WPI) Stndrd d Unit itvectors Define y i j 1,0,0 0,1,0 k i k 0,0,1

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

Section 5.3 : Finding Area Between Curves

Section 5.3 : Finding Area Between Curves MATH 9 Section 5. : Finding Are Between Curves Importnt: In this section we will lern just how to set up the integrls to find re etween curves. The finl nswer for ech emple in this hndout is given for

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

Range searching. with Range Trees

Range searching. with Range Trees Range searching Computational Geometry [csci 3250] Range searching with Range Trees Given a set of points, preprocess them into a data structure to support fast range queries. 2D Laura Toma Bowdoin College

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

UT1553B BCRT True Dual-port Memory Interface

UT1553B BCRT True Dual-port Memory Interface UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl

More information

HW Stereotactic Targeting

HW Stereotactic Targeting HW Stereotctic Trgeting We re bout to perform stereotctic rdiosurgery with the Gmm Knife under CT guidnce. We instrument the ptient with bse ring nd for CT scnning we ttch fiducil cge (FC). Above: bse

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

CS350: Data Structures Red-Black Trees

CS350: Data Structures Red-Black Trees Red-Black Trees James Moscola Department of Engineering & Computer Science York College of Pennsylvania James Moscola Red-Black Tree An alternative to AVL trees Insertion can be done in a bottom-up or

More information

EECS 281: Homework #4 Due: Thursday, October 7, 2004

EECS 281: Homework #4 Due: Thursday, October 7, 2004 EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

The Fundamental Theorem of Calculus

The Fundamental Theorem of Calculus MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementry Figure y (m) x (m) prllel perpendiculr Distnce (m) Bird Stndrd devition for distnce (m) c 6 prllel perpendiculr 4 doi:.8/nture99 SUPPLEMENTARY FIGURE Confirmtion tht movement within the flock

More information

GENERATING ORTHOIMAGES FOR CLOSE-RANGE OBJECTS BY AUTOMATICALLY DETECTING BREAKLINES

GENERATING ORTHOIMAGES FOR CLOSE-RANGE OBJECTS BY AUTOMATICALLY DETECTING BREAKLINES GENEATING OTHOIMAGES FO CLOSE-ANGE OBJECTS BY AUTOMATICALLY DETECTING BEAKLINES Efstrtios Stylinidis 1, Lzros Sechidis 1, Petros Ptis 1, Spiros Sptls 2 Aristotle University of Thessloniki 1 Deprtment of

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

Suffix trees. December Computational Genomics

Suffix trees. December Computational Genomics Computtionl Genomics Prof Irit Gt-Viks, Prof. Ron Shmir, Prof. Roded Shrn School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' עירית גת-ויקס, פרופ' רון שמיר, פרופ' רודד שרן ביה"ס למדעי

More information

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009

Sample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009 Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)

More information

Topics in Analytic Geometry

Topics in Analytic Geometry Nme Chpter 10 Topics in Anltic Geometr Section 10.1 Lines Objective: In this lesson ou lerned how to find the inclintion of line, the ngle between two lines, nd the distnce between point nd line. Importnt

More information