Orthogonal line segment intersection
|
|
- Imogen Gilmore
- 5 years ago
- Views:
Transcription
1 Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl line segments Generl cse nd Bentley-Otmn line sweep lgorithm Lur Tom Bowdoin College Lur Tom Bowdoin College Line segment intersection Line segment intersection Line segment intersection Prolem: Given set of line segments in 2D, find ll their pirwise intersections. Prolem: Given set of line segments in 2D, find ll their pirwise intersections. Prolem: Given set of line segments in 2D, find ll their pirwise intersections
2 Applictions Applictions Applictions Grphics: rendering => hidden surfces ==> intersections Motion plnning nd collision detection in utonomous systems/rootics Geogrphicl dt: River networks, rod networks, rilwys,.. R Applictions Applictions Applictions Geogrphicl dt: River networks, rod networks, rilwys,.. Mp overly in GIS Mp overly in GIS from: from: 12
3 Nive Nottion n: size of the input (numer of segments) k: size of output (numer of intersections) A specil cse: Prolem: Given set of n line segments in 2D, find ll their pirwise intersections. Algorithms Exercises: Give upper nd lower ounds for k, drw exmples tht chieve these ounds. Give strightforwrd lgorithm tht computes ll intersections nd nlyze its running time. Give scenrios when this lgorithm is efficient/inefficient. Wht is your intuition of n upper ound for this prolem? (how fst would you hope to e le to solve it?) Exercises Come up with strightforwrd lgorithm nd nlyze its time Improved lgorithm? Blnced Binry Serch Trees - review - Binry Serch Trees (BST) Opertions insert delete serch successor, predecessor trversls (in order,..) min, mx Blnced Binry Serch Trees (BBST) Binry serch trees + invrints tht constrin the tree to e lnced (nd thus hve logrithmic height) These invrints hve to e mintined when inserting nd deleting (so we cn think of the tree s self-lncing) BBST vrints red-lck trees AVL trees B-trees (,) trees
4 Exmple: Red-Blck trees Exmple: Red-Blck trees Exmple: Red-Blck trees Binry serch tree, nd Ech node is Red or Blck The children of Red node must e Blck The numer of Blck nodes on ny pth from the root to ny node tht does not hve two children must e the sme Theorem: A Red-Blck tree of n nodes hs height Thet( lg n). Theorem: After n insertion or deletion, the RB tree invrints cn e mintined in dditionl O(lg n) time. This is done y performing rottions nd recoloring nodes on the pth from the inserted/deleted node to the root. Note: esier to conceptulize the tree s contining explicit NULL leves, ll Blck the numer of Blck nodes on ny root-to-lef pth must e the sme Binry Serch Trees Opertions insert delete serch successor, predecessor trversls (in order,..) min, mx rnge serch (1D) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,)
5 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) 1D Rnge Serching Given set of vlues P = {x1, x2, x3, xn } Pre-process it in order to nswer rngeserch(,): return ll elements in P in intervl (,) If P is sttic If P is sttic If P is sttic Ides? Pre-precess: sort If P is dynmic: Rnge serch: inry serch, O( lg n + k) per query use BBST D rnge serching with Binry Serch Trees 1D rnge serching with Binry Serch Trees 1D rnge serching with Binry Serch Trees Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51, 52 Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51, 52 Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51,
6 1D rnge serching with Binry Serch Trees 1D Rnge Serching with Red-Blck Trees 1D rnge serching with Binry Serch Trees Exmple: rnge_serch(21, 53): return 21, 34, 35, 46, 51, 52 Exmple: rnge_serch(10, 16): return 11, 13, 15 Rnge serch (,): return ll elements in this intervl D rnge serching with Binry Serch Trees Rnge serch (,): return ll elements in this intervl Cn e nswered in O( lg n+k), where k = O(n) is the size of output
7 solve the prolem ehind the line solve the prolem ehind the line //the events //our events //our events Sort X nd trverse the events in order Sort X nd trverse the events in order xstrt xend x solve the prolem ehind the line solve the prolem ehind the line solve the prolem ehind the line //our events //our events //our events Sort X nd trverse the events in order Sort X nd trverse the events in order Sort X nd trverse the events in order
8 solve the prolem ehind the line Events Line sweep technique Trverse events in order nd mintin n Active Structure (AS) AS contins ojects tht re ctive (strted ut not ended) in other words they re intersected y the present sweep line t certin events, insert in AS Events eginning of horizontl segment end of horizontl segment Events eginning of horizontl segment end of horizontl segment t certin events, delete from AS t other events, query AS verticl segment verticl segment
9
10 Line sweep Pick n exmple nd simulte the lgorithm How do you implement the AS? Anlysis? Frequently used technique Line cn e horizontl or verticl or rdil or. Trverse events in order nd mintin n Active Structure (AS) AS mintins ojects tht re ctive (strted ut not ended) in other words they re intersected y the present sweep line t certin events, insert in AS t certin events, delete from AS t other events, query AS 58 59
Orthogonal line segment intersection. Computational Geometry [csci 3250] Laura Toma Bowdoin College
Orthogonal line segment intersection Computational Geometry [csci 3250] Laura Toma Bowdoin College Line segment intersection The problem (what) Applications (why) Algorithms (how) A special case: Orthogonal
More informationLine segment intersection (I): Orthogonal line segment intersection. Computational Geometry [csci 3250] Laura Toma Bowdoin College
Line segment intersection (I): Orthogonal line segment intersection Computational Geometry [csci 3250] Laura Toma Bowdoin College Outline The problem (what) Applications (why) Algorithms (how) A special
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationDeletion The Two Child Case 10 Delete(5) Deletion The Two Child Case. Balanced BST. Finally
Deletion Te Two Cild Cse Delete() Deletion Te Two Cild Cse Ide: Replce te deleted node wit vlue gurnteed to e etween te two cild sutrees! Options: succ from rigt sutree: findmin(t.rigt) pred from left
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationbinary trees, expression trees
COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry
More information2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationCS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014.
1 CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces!! Prof. Jmes O Brien University of Cliforni, Berkeley! V2013F101.0 Tody 2 Clipping Clipping to view volume Clipping ritrry polygons Hidden
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationCS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons
CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces Prof. Jmes O Brien University of Cliforni, Berkeley V2008S101.0 1 Tody Clipping Clipping to view volume Clipping ritrry polygons Hidden Surfce
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More information4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E
4-1 NAME DATE PERIOD Pges 142 147 Prllel Lines nd Plnes When plnes do not intersect, they re sid to e prllel. Also, when lines in the sme plne do not intersect, they re prllel. But when lines re not in
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationProduct of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials
Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationApplications of the Definite Integral ( Areas and Volumes)
Mth1242 Project II Nme: Applictions of the Definite Integrl ( Ares nd Volumes) In this project, we explore some pplictions of the definite integrl. We use integrls to find the re etween the grphs of two
More informationLecture 10: Suffix Trees
Computtionl Genomics Prof. Ron Shmir, Prof. Him Wolfson, Dr. Irit Gt-Viks School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' רון שמיר, פרופ' חיים וולפסון, דר' עירית גת-ויקס ביה"ס למדעי
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More information8.2 Areas in the Plane
39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to
More informationB. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a
Mth 176 Clculus Sec. 6.: Volume I. Volume By Slicing A. Introduction We will e trying to find the volume of solid shped using the sum of cross section res times width. We will e driving towrd developing
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More information4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy
/9/8 Fioncci (Leonrdo Pisno) -? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS Spring 8 Fioncci function fi() fi() fi(n) fi(n-) + fi(n-) for n,,,,,, 8,,, In his ook in titled Lier
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationApproximate computations
Living with floting-point numers Stndrd normlized representtion (sign + frction + exponent): Approximte computtions Rnges of vlues: Representtions for:, +, +0, 0, NN (not numer) Jordi Cortdell Deprtment
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More informationx )Scales are the reciprocal of each other. e
9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More information50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:
5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationLesson 11 MA Nick Egbert
Lesson MA 62 Nick Eert Overview In this lesson we return to stndrd Clculus II mteril with res etween curves. Recll rom irst semester clculus tht the deinite interl hd eometric menin, nmel the re under
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationLecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI)
Computer Grphics (CS 4731) Lecture 7: Building 3D Models (Prt 1) Prof Emmnuel Agu Computer Science Dept. Worcester Polytechnic Institute (WPI) Stndrd d Unit itvectors Define y i j 1,0,0 0,1,0 k i k 0,0,1
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationSection 5.3 : Finding Area Between Curves
MATH 9 Section 5. : Finding Are Between Curves Importnt: In this section we will lern just how to set up the integrls to find re etween curves. The finl nswer for ech emple in this hndout is given for
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationRange searching. with Range Trees
Range searching Computational Geometry [csci 3250] Range searching with Range Trees Given a set of points, preprocess them into a data structure to support fast range queries. 2D Laura Toma Bowdoin College
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationHW Stereotactic Targeting
HW Stereotctic Trgeting We re bout to perform stereotctic rdiosurgery with the Gmm Knife under CT guidnce. We instrument the ptient with bse ring nd for CT scnning we ttch fiducil cge (FC). Above: bse
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationCS350: Data Structures Red-Black Trees
Red-Black Trees James Moscola Department of Engineering & Computer Science York College of Pennsylvania James Moscola Red-Black Tree An alternative to AVL trees Insertion can be done in a bottom-up or
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationThe Fundamental Theorem of Calculus
MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure y (m) x (m) prllel perpendiculr Distnce (m) Bird Stndrd devition for distnce (m) c 6 prllel perpendiculr 4 doi:.8/nture99 SUPPLEMENTARY FIGURE Confirmtion tht movement within the flock
More informationGENERATING ORTHOIMAGES FOR CLOSE-RANGE OBJECTS BY AUTOMATICALLY DETECTING BREAKLINES
GENEATING OTHOIMAGES FO CLOSE-ANGE OBJECTS BY AUTOMATICALLY DETECTING BEAKLINES Efstrtios Stylinidis 1, Lzros Sechidis 1, Petros Ptis 1, Spiros Sptls 2 Aristotle University of Thessloniki 1 Deprtment of
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationSuffix trees. December Computational Genomics
Computtionl Genomics Prof Irit Gt-Viks, Prof. Ron Shmir, Prof. Roded Shrn School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' עירית גת-ויקס, פרופ' רון שמיר, פרופ' רודד שרן ביה"ס למדעי
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationTopics in Analytic Geometry
Nme Chpter 10 Topics in Anltic Geometr Section 10.1 Lines Objective: In this lesson ou lerned how to find the inclintion of line, the ngle between two lines, nd the distnce between point nd line. Importnt
More information