Companion Mathematica Notebook for "What is The 'Equal Weight View'?"
|
|
- Liliana Anderson
- 6 years ago
- Views:
Transcription
1 Compnion Mthemtic Notebook for "Wht is The 'Equl Weight View'?" Dvid Jehle & Brnden Fitelson < July 9 The methods used in this notebook re specil cses of more generl decision procedure for the probbility clculus clled PrSAT which is described in this pper < nd which cn be downloded here < Tble Exmple: p q P P P P T T..55 d T F..5 b e F T..5 c f F F b - c - d - e - f Assume p & q nd p & ~q re only peer-propositions. Then pplying (SA) we ll hve: p q P P P P T T T F F T..5???? F F.4.5???? Tble Exmple: When we pply (SAMC) we end-up with: p q P P P P T T T F F T..5 c F F.4.5 b d Here is the minimiztion code tht yields the (unique) (SAMC)-solutions for b c d. Minimize@8EuclidenDistnce@8....4< b<d HPlus üü b<l == &&< < &&< b < < 8 b<d Ø.75 b Ø.75<< Minimize@8EuclidenDistnce@ < c d<d HPlus üü c d<l == &&< c < &&< d < < 8c d<d c Ø.75 d Ø.75<< Thus (SAMC) yields the following pir of updted distributions: p q P P P P T T T F F T F F
2 ew.nb Tble Exmple: Now if we dd the further ssumption tht p nd q re lso peer-propositions we get the following single distribution: p q P P P = P T T T F..5.5 F T..5.5 F F But this solution violtes (C) since: P i (q p) = P i Hq& pl.5 = =.5999 P P i HpL.5+.5 Hq pl+p Hq pl = P Hq& pl + P Hq& pl P HpL P HpL = =.547. Wht if we weken (SAMC) to only require pproximte stright verging (ASAMC)? There re three versions of this sort of rule tht we consider in the pper. The first is the wekest: it only requires tht ech peer get close to the stright verge. First we define º b iff b < e. Then on the wekest version of the rule we need to require tht ech peer ends-up stisfying (P) nd (C) nd lso ends-up close to the stright verge. More precisely in the exmple bove we re looking for pir of vectors <bcd> nd <efgh> such tht º.5 b º.5 c º.5 nd d º.5 nd (P) nd (C) re stisfied by <bcd> nd e º.5 f º.5 g º.5 nd h º.5 nd (P) nd (C) re stisfied by <efgh>. Moreover we wnt both vectors to be in between P nd P. p q P P P P T T..55 e T F..5 b f F T..5 c g F F.4.5 d h Here we see tht (even on this wekest rendition of ASAMC) ny solution requires tht e > 6. FindInstnceB.5 -e< <.5. < <.55 &&.5 -e<b <.5. < b <.5 &&.5 -e<c <.5.5 < c <. &&.5 -e<d <.5.5 < d <.4 && <e< 5 && && + b + c + d ã &&.5 -e<e <.5. < e <.55 &&.5 -e<f <.5. < f <.5 &&.5 -e<g <.5.5 < g <. && e<h <.5.5 < h <.4 && <e 5 && e e + f == e + f + g + h ã && e&&b f&&c g&&d h 8 b c d e f g h e<f 88 Ø b Ø c Ø.4686 d Ø.454 e Ø.66 f Ø g Ø.6878 h Ø.75 eø.6694<< &&
3 ew.nb FindInstnceB.5 -e< <.5. < <.55 &&.5 -e<b <.5. < b <.5 &&.5 -e<c <.5.5 < c <. &&.5 -e<d <.5.5 < d <.4 && <e< 5 && && + b + c + d ã &&.5 -e<e <.5. < e <.55 &&.5 -e<f <.5. < f <.5 &&.5 -e<g <.5.5 < g <. && e<h <.5.5 < h <.4 && <e 6 && e e + f == e + f + g + h ã && e&&b f&&c g&&d h 8 b c d e f g h e<f The strongest version of this pproximte strtegy forces the two peers to end-up in exct greement on ll peer-propositions nd to be close to splitting the difference s well. For instnce let e =.5. Then the question is this (for the strongest rendition). Is there vector <bcd> such tht º.5 b º.5 c º.5 nd d º.5 nd (P) nd (C) re stisfied by the resulting vector? Moreover we wnt these vlues to be in between P nd P. p q P P P = P T T..55 T F..5 b F T..5 c F F.4.5 d Once gin the only wy to stisfy this is if e > 6. && FindInstnceB.5 -e< <.5. < <.55 &&.5 -e<b <.5. < b <.5 &&.5 -e<c <.5.5 < c <. &&.5 -e<d < < d <.4 && <e< 5 && && + b + c + d ã 8 b c d e<f 88 Ø b Ø c Ø.4686 d Ø.454 eø.6694<< FindInstnceB.5 -e< <.5. < <.55 &&.5 -e<b <.5. < b <.5 &&.5 -e<c <.5.5 < c <. &&.5 -e<d <.5.5 < d <.4 && <e 6 && && + b + c + d ã 8 b c d e<f Wht if we lso require (PCI) to be stisfied s well? In the bove exmple both gents strt out greeing tht p nd q re negtively dependent. Thus (PCI) requires tht we ensure they continue to gree bout this. This dds n dditionl constrint. But so long s (C) is stisfied (i.e. if e > ) this constrint cn lso be met. In generl this will be the cse (t lest for the - 6 tomic-proposition cse).
4 4 ew.nb FindInstnceB.5 -e< <.5. < <.55 &&.5 -e<b <.5. < b <.5 &&.5 -e<c <.5.5 < c <. &&.5 -e<d <.5.5 < d <.4 && <e 5 && && + b > && + b + c + d ã 8 b c d e<f + c 88 Ø.655 b Ø.4989 c Ø.7779 d Ø.884 eø << FindInstnceB.5 -e< <.5. < <.55 &&.5 -e<b <.5. < b <.5 &&.5 -e<c <.5.5 < c <. &&.5 -e<d <.5.5 < d <.4 && <e< 6 && && + b > Here s n exmple ner our Tble exmple which requires e >.5: p q P T T T F P 5 P = P F T..5 c F F.4.5 d b && + b + c + d ã 8 b c d e<f + c test@8e_ f_ g_ h_< 8i_ j_ k_ l_< x_d := FindInstnceB e + i -e< < e + i If@e > i i < < e e < < id && f + j -e<b < f + j If@j > f f < b < j j < b < fd && g + k -e<c < g + k If@k > g g < c < k k < c < gd && h + l -e<d < h + l If@l > h h < d < l l < d < hd && <e x&& e e+f + i i+j testb: && + b + c + d ã &&e+ f + g + h ã &&i+ j + k + l ã 8 b c d e<f; > : 5 >.5F 5 5 testb: > : >.6F 88 Ø b Ø.7494 c Ø.495 d Ø.8495 eø.6<< ü Code for lrger e cse serch ner our Tble exmple Reverse engineering lrger e cse ner Tble (for the strongest rendition of ASAMC): p q P P P = P T T x y T F z u b F T..5 c F F.4.5 d
5 ew.nb 5 FindExmple@x_ y_ z_ u b_ c_ d_ x_d := FindInstnceBx + z ã &&y+ u ã &&< x < &&< y < && x + y < z < &&< u < &&" 8e<<e<x!$ 8bcd<H b c dlœrels -e< < x + y If@y > x x < < y y < < xd && z + u -e<b < z + u If@u > z z < b < u u < b < zd && + 5 -e<c < < c < && e<d < < d < 4 && + b ã x x + y + z x + u && + b + c + d ã 8x y z u< RelsF; FindExmpleBx y z 9 b F FindInstnceB 7 + x + z ã && + y ã &&< x < && 5 < y < &&< z < &&" 8e<<e< " 8b<H blœrels! x + y -e< < x + y If@y > x x < < y y < < xd && z + 5 -e<b < z IfB 5 > z z < b < 5 5 < b < zf && 5 < 9 < && e< 5 < 9 -e< < < 5 < 4 && + b ã x x + y + z x + 5 && + b ã 8x y z< Rels FPT :x Ø yø 7 97 zø > Verifying the exmple: test@8e_ f_ g_ h_< 8i_ j_ k_ l_< x_d := FindInstnceB e + i -e< < e + i If@e > i i < < e e < < id && f + j -e<b < f + j If@j > f f < b < j j < b < fd && g + k -e<c < g + k If@k > g g < c < k k < c < gd && h + l -e<d < h + l If@l > h h < d < l l < d < hd && <e<x&& e e+f + i i+j && + b + c + d ã &&e+ f + g + h ã &&i+ j + k + l ã 8 b c d e<f;
6 6 ew.nb testb: testb: > : 5 > : 5 >.F 5 5 >.5F 5 5 testb: > : >.6F 88 Ø b Ø.7494 c Ø.49 d Ø.849 eø.5995<<
MATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationAnswer Key Lesson 6: Workshop: Angles and Lines
nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationThe Fundamental Theorem of Calculus
MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationChapter Spline Method of Interpolation More Examples Electrical Engineering
Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.
More information)
Chpter Five /SOLUTIONS Since the speed ws between nd mph during this five minute period, the fuel efficienc during this period is between 5 mpg nd 8 mpg. So the fuel used during this period is between
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationClass-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts
Clss-XI Mthemtics Conic Sections Chpter-11 Chpter Notes Key Concepts 1. Let be fixed verticl line nd m be nother line intersecting it t fixed point V nd inclined to it t nd ngle On rotting the line m round
More informationAn Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization
An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction
More informationMisrepresentation of Preferences
Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationSolutions to Math 41 Final Exam December 12, 2011
Solutions to Mth Finl Em December,. ( points) Find ech of the following its, with justifiction. If there is n infinite it, then eplin whether it is or. ( ) / ln() () (5 points) First we compute the it:
More informationLecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure
Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationTECHNICAL NOTE MANAGING JUNIPER SRX PCAP DATA. Displaying the PCAP Data Column
TECHNICAL NOTE MANAGING JUNIPER SRX PCAP DATA APRIL 2011 If your STRM Console is configured to integrte with the Juniper JunOS Pltform DSM, STRM cn receive, process, nd store Pcket Cpture (PCAP) dt from
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationDigital Design. Chapter 6: Optimizations and Tradeoffs
Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationSubtracting Fractions
Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationIntroduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example
Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847
More informationIntegration. October 25, 2016
Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve
More informationAssignment 11 (The Last One) Due Date for Programs: December 13, 2016
Jonn Klukowsk jonnkl@cs.nyu.edu Due Dte for Progrms: December 13, 2016 Problem 1 (10 points): Wht does this code do? Tke look t code below nd output tht it produces. Try to figure out exctly wht is going
More informationConstrained Optimization. February 29
Constrined Optimiztion Februry 9 Generl Problem min f( ) ( NLP) s.. t g ( ) i E i g ( ) i I i Modeling nd Constrints Adding constrints let s us model fr more richer set of problems. For our purpose we
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More information6.2 Volumes of Revolution: The Disk Method
mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes
More informationData sharing in OpenMP
Dt shring in OpenMP Polo Burgio polo.burgio@unimore.it Outline Expressing prllelism Understnding prllel threds Memory Dt mngement Dt cluses Synchroniztion Brriers, locks, criticl sections Work prtitioning
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationMA 124 (Calculus II) Lecture 2: January 24, 2019 Section A3. Professor Jennifer Balakrishnan,
Wht is on tody Professor Jennifer Blkrishnn, jbl@bu.edu 1 Velocity nd net chnge 1 2 Regions between curves 3 1 Velocity nd net chnge Briggs-Cochrn-Gillett 6.1 pp. 398-46 Suppose you re driving long stright
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationProduct of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials
Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationOn String Matching in Chunked Texts
On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd
More information1 The Definite Integral
The Definite Integrl Definition. Let f be function defined on the intervl [, b] where
More informationFall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.
15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationMath 142, Exam 1 Information.
Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At
More informationRational Numbers---Adding Fractions With Like Denominators.
Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b
More informationx )Scales are the reciprocal of each other. e
9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationDouble Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals
Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls
More information9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association
9. CISC - Curriculum & Instruction Steering Committee The Winning EQUATION A HIGH QUALITY MATHEMATICS PROFESSIONAL DEVELOPMENT PROGRAM FOR TEACHERS IN GRADES THROUGH ALGEBRA II STRAND: NUMBER SENSE: Rtionl
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationFig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.
Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationCOMPUTATIONAL INTELLIGENCE
COMPUTATIONAL INTELLIGENCE LABORATORY CLASSES Immentton smplstc verson of the network for some nference resons Adrn Horzyk IMPLEMENTATION OF THE SIMPLISTIC OR AANG Imment the smplstc verson of n structure
More informationGuide for sending an Electronic Dental referral
Guide for sending n Electronic Dentl referrl 1. Lunch Rego vi your Ptient Record System Open the Rego referrl templte vi your Ptient Record System: Exct / SOE: Open the ptient record, then click on Ptient
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationMatlab s Numerical Integration Commands
Mtlb s Numericl Integrtion Commnds The relevnt commnds we consider re qud nd dblqud, triplequd. See the Mtlb help files for other integrtion commnds. By the wy, qud refers to dptive qudrture. To integrte:
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More informationDeposit a Technical Report in PubRep
Technicl in Lst Updte:19.12.016 Te c h n i c l Technicl s re mjor source of scientific informtion, prepred for institutionl nd wider distribution. They re considered grey literture since they re scientific
More informationPhysics 152. Diffraction. Difrraction Gratings. Announcements. Friday, February 2, 2007
ics Fri Feb.02. Announcements Diffrction Difrrction Grtings Fridy, Februry 2, 2007 Help sessions: W 9-10 pm in NSC 118 Msteringics WU #5 due Mondy WU #6 due Wednesdy http://www.voltnet.com/ldder/ A bem
More informationGraphing Conic Sections
Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where
More informationThis notebook investigates the properties of non-integer differential operators using Fourier analysis.
Frctionl erivtives.nb Frctionl erivtives by Fourier ecomposition by Eric Thrne 4/9/6 This notebook investigtes the properties of non-integer differentil opertors using Fourier nlysis. In[]:=
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationTilings of Sphere by Congruent Pentagons I
rxiv:1310.19v5 [mth.mg] 8 Mr 018 Tilings of Sphere by Congruent Pentgons I K Yue Cheuk, Ho Mn Cheung, Min Yn Hong Kong University of Science nd Technology Mrch 9, 018 Abstrct We develop some bsic tools
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationOn the Detection of Step Edges in Algorithms Based on Gradient Vector Analysis
On the Detection of Step Edges in Algorithms Bsed on Grdient Vector Anlysis A. Lrr6, E. Montseny Computer Engineering Dept. Universitt Rovir i Virgili Crreter de Slou sin 43006 Trrgon, Spin Emil: lrre@etse.urv.es
More information