The Search for Optimality in Automated Intrusion Response
|
|
- Mervin Blair
- 6 years ago
- Views:
Transcription
1 The Serch for Optimlity in Automted Intrusion Response Yu-Sung Wu nd Surbh Bgchi (DCSL) & The Center for Eduction nd Reserch in Informtion Assurnce nd Security (CERIAS) School of Electricl nd Computer Engineering Purdue University Work supported by: Purdue Reserch Foundtion, Avy, CERIAS Slide 1/20 Survivble Systems nd Intrusion Response Modern life hevily depends on computer systems Intrusions/security breches to these systems occur Wys to mke system survivble At design/implementtion phse Eliminte vulnerbilities Policy/Access Control/Cryptogrphy/Forml Verifiction In production phse Use IDS (system logs checking/network pcket sniffing/virus, worms scnning, detecting files modifictions ) to identify misuses/nomlies Perform incident/intrusion response (IRS) to detected misuses/nomlies Continment nd Recovery Focus of this work Slide 2/20
2 Intrusion Response System The need for IRS A survivble system needs to provide functionlity through intrusions Humn intervention fter IDS lert cn be costly nd slow IRS tkes reports from IDS (usully bundled together), processes it, nd crries out ctions to counter the intrusion Existing exmples of IRS Anti-virus softwre which disbles ccess to worm executbles or files infected with virus Routers/firewlls which ctively block worm trffic Lptops equipped with motion sensor nd TPM module tht cn lock up the computer when unuthorized movement (usully occurs when the lptop is being stolen) is detected Slide 3/20 Intrusion Response System Summry on existing IRS Most of them re stnd-lone nd re tied with one single nd specific detector (IDS) Trget mostly t one mchine box only IRS for Distributed Systems An environment of multiple interconnected boxes with heterogeneous nd cooperting services Few generl-purpose IRS solutions exist for distributed systems The most common wy is to use the stnd-lone solutions seprtely nd independently on the boxes E.g., Hve McAfee nti-virus softwre instlled on the worksttion boxes, nd CISCO IPS on the network joints. Slide 4/20
3 IRS for Distributed Systems Drwbck of the common wy Ech IRS/IDS pir does not leverge the detection reports from the other IDSs Existing reserch on correltion IDS hve shown cler dvntges of doing so The IRS/IDS pir does not consider the effects from the response ctions crried out by the other IRS/IDS pirs This cn led to redundnt response ctions nd denil-of-service of the system t worst. At best, loclly optiml decisions from ech IRS/IDS pir There is no gurntee of system-wide globl optimlity Slide 5/20 ADEPTS IRS: Bsics Specificlly designed for distributed systems Use I-GRAPH ( vrint of ttck grph) s the core binding between detectors (stnd-lone IDSs) nd response ctions (stndlone IRSs) A detector is ssocited with n I- GRAPH node to tell the confidence index of tht node being compromised The compromise confidence index of nodes without ssocited detectors cn be inferred through the grph structure Response ctions re ssocited with edges A response is ment to stop the progression of the intrusion from the source node to the destintion node OR n QUORUM AND 3. Illegl ccess to http document root Detector D Response X 12. Execute rbitrry code on MySQL host 1. SSL module buffer overflow in Apche host 1 Detector A 2.Execute rbitrry code on Apche host MySQL informtion lek Detector B 9. MySQL buffer overflow Response Y 4. Send mlicious chunk encoded pcket 10. DoS of MySQL 2 7. DoS of Apche host 1 6. Chunk hndling buffer overflow on Apche host DoS webstore Detector C 8. DoS of Apche host 2 5. C librry code buffer overflowed Response Z Slide 6/20
4 Attck Phses The dynmics between intrusion nd response v b w c f y d h I-GRAPH X Y d Z d h b b c b c R f X R Y R Z Assuming n ttck includes three snpshots X, Y, nd Z clled ttck phses Ech snpshot includes I-GRAPH nodes which hve been chieved s prt of the ttck thus fr Following ech snpshot k, ADEPTS determines set of response ctions R k for deployment Slide 7/20 Dignosis of Achieved I-GRAPH Nodes Responses in I-GRAPH Detector X A.C. = 1 Mlwre downloded to stff computer CCI = 1 e.p.p = e.p.p = 0.8 Detector Y 0.8 A.C. = 0.6 Pssword Chnge keystroke grdes r recorded x r y recorded CCI = 0.16 CCI = 0.33 Assume: Prob(r x fils) = 0.2 Prob(r y fils) = 0.4 For n edge e connecting node to b in I-GRAPH with response r : cci() Prob(r fils) epp(e), if b hs no detector cci(b) = [ cci() Prob(r fils) epp(e) + AC(x) ], if b hs detector x 2 epp(e) : The edge propgtion probbility of edge e. This models n dversry s likelihood of tking this edge ADEPTS deploys responses on the ttck phse bsed on the CCI vlue of node Slide 8/20
5 Impct Vector A system hs trnsction gols nd security gols tht it needs to meet through the time of opertion Exmple: providing e-mil service nd ensuring the confidentility of sensitive dt Attcks re ment to impct some of these gols Deployed responses lso impct some of these gols Assume the impct from n ttck to the system cn be quntified through vector IV with ech element in the IV corresponding to the impct on ech trnsction/security gol [0, 1] Impct vector for dversry reching I-GRAPH node n k is IV(n k ) Impct vector for response r k is IV(r k ) Slide 9/20 Optimlity of Response Actions We formlly define the cost for response combintion ( set of response ctions) RC i s: m n i = i = k k + k k= 1 k= 1 Cost( RC ) Iv( RC ) Iv( n )Prob( n ) Iv( r ) In our ttck grph model, Prob(n k ) is estimted s CCI(n k ) Accurtely speking, Prob(n k ) is conditioned on mny fctors, nd determining its vlue is by itself chllenging reserch problem The response combintion RC i is sid to be optiml for the given ttck if it chieves minimum Cost(RC i ) Slide 10/20
6 Types of Response Actions Given snpshot s nd I-GRAPH G In terms of continment, ADEPTS should consider ll response ctions pplicble to the grph (G-s) In terms of recovery, ADEPTS should consider ll response ctions pplicble to the grph s s is typiclly not huge, s its size is liner in the number of detectble steps in multi-stge ttck But (G-s) cn be huge A function of pplicble ttck steps (vulnerbilities) in ll services in the ppliction system However, for nodes in (G-s) which re fr wy from s, the likelihood of them being reched is lower thn for closer ones Slide 11/20 Domin Grph Our solution is to limit the response serch spce for snpshot s to subset of (G-s), nmely the domin grph D(s) D(s) includes criticl nodes from I-GRAPH A node n is criticl if CCI n *IV n is greter thn given threshold The current snpshot S (chieved ttck stges) b c f d e k g j h i Domin Grph D(S) : chieved : non-chieved / criticl : non-chieved / non-criticl Slide 12/20
7 Approximte O.R.D. with Genetic Algorithm Optiml Response Determintion is proved to be NPhrd by mpping the Set Covering Problem to it The current snpshot S (chieved ttck stges) Encode the set R of responses pplicble within D(S) into chromosomes; Fitness of chromosome relted to cost b c f Apply Genetic Algorithm Solver: Crossover/Muttion/ Elitism Preserve the top chromosomes for future ttcks tht hve similr snpshots s s d e k g j h i Domin Grph D(S) : chieved : non-chieved / criticl : non-chieved / non-criticl Pick the best chromosome (the best response combintion) s the pproximte solution to ORD. Slide 13/20 Genetic Algorithm bsed Solver for ORD Why choose G.A.? Derivtive bsed optimiztion techniques do not work s our objective function is discrete Since exct problem is NP-hrd, one hs to look for pproximte serch Trde-off between the optimlity of the solutions nd the computtionl expense is djustble by controlling the size of the domin grph nd the number of evolutions in the GA bsed solver Good solutions (response combintions) from previous instnces re preserved into the chromosome popultion for future instnces of similr ttcks This speeds up the serch of good response combintions for future ttcks which re similr to the current one Slide 14/20
8 Experiment nd preliminry results The testbed A three-tier ecommerce system s the reference bsis for constructing ttck scenrios. Apche Tomct Apche Lod Blncer IPTbles Apche Tomct JBoss AS Jv PetStore Controller JBoss AS Jv PetStore Components MySQL A drone bsed testing frmework RESPONSE MESSAGES ATTACK MESSAGE Slide 15/20 Experiment nd Preliminry results Attck scenrios 0.C Ping or trceroute to web servers 2.A Exploit ssldump vuln. on web server 3.A Copy hcker tool to web svr using tftp 1.C Run portscnner on web servers 2.B.1 Access web server dmin site 2.B.2 Brute force dmin pssword 3.B Instll vuln. scnner on web svr Attck scenrios 3 nd 4, used for experimentl evlution. Boxes with A nd B denote the stges for scenrio 3 nd 4 respectively, while C denotes stges common to both. 5.A Exploit rpc.sttd service on pp controller 4.C Run port scnner on internl network 6.A Brute force root pwd on pp controller 6.B Exploit remote vuln. on MySQL 7.C Run MySQL modifiction queries on dtbse tbles Slide 16/20
9 Experiment Comprison ginst Bseline ADEPTS vs. the bseline (loclly optimized responses) Attck Scenrio 3 8 Survivbility ADEPTS Bseline ADEPTS Number of itertions Slide 17/20 Experiment Incorrect Initil Conditions ADEPTS where initil settings (effectiveness of responses, IV vlues, etc.) re incorrect, sy due to inexperienced sysdmin Attck Scenrio Survivbility ADEPTS Bseline ADEPTS Number of itertions After 16 itertions of the ttck, the effect of incorrect initil prmeters disppers Slide 18/20
10 Experiment Lerning from Similrity Utilizing the informtion (chromosomes) from similr ttcks Attck Scenrio 4 nd vrint Attck Scenrio Survivbility AS4 with history AS4 without history Number of itertions For one cse, AS4 is run fter running its vrint AS3 nd generting history. For the other, AS4 is run without such history. It tkes 8 itertions for the ltter to ctch up. Slide 19/20 Wrp-up Defined frmework to reson bout optimlity of intrusion responses in distributed systems The frmework is implemented using genetic lgorithm bsed solver since exct solution is NP-hrd Experiments with rel multi-stge ttcks indicte tht globlly optimizing response choices is beneficil Wht s coming next: How cn the number of evolutions of the GA be determined? Wht hppens if some detectors re misconfigured nd ttck phses re incomplete? How to hndle incomplete I-GRAPHs? Slide 20/20
Encoding techniques for evading n-gram based Intrusion Detection Systems
Encoding techniques for evding n-grm bsed Intrusion Detection Systems Studienrbeit Moritz Bechler moritz.bechler@student.uni-tuebingen.de Universität Tübingen Wilhelm Schickrd Institut SPRING 7 5.7.2012
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationElena Baralis, Silvia Chiusano Politecnico di Torino. Pag. 1. Query optimization. DBMS Architecture. Query optimizer. Query optimizer.
DBMS Architecture SQL INSTRUCTION OPTIMIZER Dtbse Mngement Systems MANAGEMENT OF ACCESS METHODS BUFFER MANAGER CONCURRENCY CONTROL RELIABILITY MANAGEMENT Index Files Dt Files System Ctlog DATABASE 2 Query
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationA New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method
A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationLooking up objects in Pastry
Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationTree Structured Symmetrical Systems of Linear Equations and their Graphical Solution
Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationEnginner To Engineer Note
Technicl Notes on using Anlog Devices DSP components nd development tools from the DSP Division Phone: (800) ANALOG-D, FAX: (781) 461-3010, EMAIL: dsp_pplictions@nlog.com, FTP: ftp.nlog.com Using n ADSP-2181
More informationISG: Itemset based Subgraph Mining
ISG: Itemset bsed Subgrph Mining by Lini Thoms, Stynryn R Vlluri, Kmlkr Krlplem Report No: IIIT/TR/2009/179 Centre for Dt Engineering Interntionl Institute of Informtion Technology Hyderbd - 500 032, INDIA
More informationOn Computation and Resource Management in Networked Embedded Systems
On Computtion nd Resource Mngement in Networed Embedded Systems Soheil Ghisi Krlene Nguyen Elheh Bozorgzdeh Mjid Srrfzdeh Computer Science Deprtment University of Cliforni, Los Angeles, CA 90095 soheil,
More informationFile Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment
File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationComplete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
More informationDQL: A New Updating Strategy for Reinforcement Learning Based on Q-Learning
DQL: A New Updting Strtegy for Reinforcement Lerning Bsed on Q-Lerning Crlos E. Mrino 1 nd Edurdo F. Morles 2 1 Instituto Mexicno de Tecnologí del Agu, Pseo Cuhunáhuc 8532, Jiutepec, Morelos, 6255, MEXICO
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationUSING HOUGH TRANSFORM IN LINE EXTRACTION
Stylinidis, Efstrtios USING HOUGH TRANSFORM IN LINE EXTRACTION Efstrtios STYLIANIDIS, Petros PATIAS The Aristotle University of Thessloniki, Deprtment of Cdstre Photogrmmetry nd Crtogrphy Univ. Box 473,
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationMigrating vrealize Automation to 7.3 or March 2018 vrealize Automation 7.3
Migrting vrelize Automtion to 7.3 or 7.3.1 15 Mrch 2018 vrelize Automtion 7.3 You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/ If you hve comments bout
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationDigital Design. Chapter 6: Optimizations and Tradeoffs
Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationEnsuring PCI DSS Compliance with the Mist Learning WLAN THE SAFE CHOICE FOR MISSION CRITICAL WIRELESS NETWORKS IN PCI ENVIRONMENTS
Ensuring PCI DSS Complince with the Mist Lerning WLAN THE SAFE CHOICE FOR MISSION CRITICAL WIRELESS NETWORKS IN PCI ENVIRONMENTS Tble of Contents Ensuring PCI DSS Complince with the Mist Lerning WLAN...
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationEfficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc
4th Ntionl Conference on Electricl, Electronics nd Computer Engineering (NCEECE 2015) Efficient Regulr Expression Grouping Algorithm Bsed on Lbel Propgtion Xi Chen, Shuqio Chenb nd Ming Moc Ntionl Digitl
More informationFault injection attacks on cryptographic devices and countermeasures Part 2
Fult injection ttcks on cryptogrphic devices nd countermesures Prt Isrel Koren Deprtment of Electricl nd Computer Engineering University of Msschusetts Amherst, MA Countermesures - Exmples Must first detect
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationAn Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization
An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction
More informationA Heuristic Approach for Discovering Reference Models by Mining Process Model Variants
A Heuristic Approch for Discovering Reference Models by Mining Process Model Vrints Chen Li 1, Mnfred Reichert 2, nd Andres Wombcher 3 1 Informtion System Group, University of Twente, The Netherlnds lic@cs.utwente.nl
More informationChapter Spline Method of Interpolation More Examples Electrical Engineering
Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.
More informationCS 268: IP Multicast Routing
Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationA Formalism for Functionality Preserving System Level Transformations
A Formlism for Functionlity Preserving System Level Trnsformtions Smr Abdi Dniel Gjski Center for Embedded Computer Systems UC Irvine Center for Embedded Computer Systems UC Irvine Irvine, CA 92697 Irvine,
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationII. THE ALGORITHM. A. Depth Map Processing
Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A
More informationMcAfee Network Security Platform
NTBA Applince T-200 nd T-500 Quick Strt Guide Revision B McAfee Network Security Pltform 1 Instll the mounting rils Position the mounting rils correctly nd instll them t sme levels. At the front of the
More informationText mining: bag of words representation and beyond it
Text mining: bg of words representtion nd beyond it Jsmink Dobš Fculty of Orgniztion nd Informtics University of Zgreb 1 Outline Definition of text mining Vector spce model or Bg of words representtion
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationEECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining
EECS150 - Digitl Design Lecture 23 - High-level Design nd Optimiztion 3, Prllelism nd Pipelining Nov 12, 2002 John Wwrzynek Fll 2002 EECS150 - Lec23-HL3 Pge 1 Prllelism Prllelism is the ct of doing more
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationvcloud Director Service Provider Admin Portal Guide vcloud Director 9.1
vcloud Director Service Provider Admin Portl Guide vcloud Director 9. vcloud Director Service Provider Admin Portl Guide You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More informationvcloud Director Service Provider Admin Portal Guide 04 OCT 2018 vcloud Director 9.5
vcloud Director Service Provider Admin Portl Guide 04 OCT 208 vcloud Director 9.5 You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/ If you hve comments
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationEvolutionary Approaches To Minimizing Network Coding Resources
This full text pper ws peer reviewed t the direction of IEEE Communictions Society suject mtter experts for puliction in the IEEE INFOCOM 2007 proceedings. Evolutionry Approches To Minimizing Network Coding
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationMemory-Optimized Software Synthesis from Dataflow Program Graphs withlargesizedatasamples
EURSIP Journl on pplied Signl Processing 2003:6, 54 529 c 2003 Hindwi Publishing orportion Memory-Optimized Softwre Synthesis from tflow Progrm Grphs withlrgesizetsmples Hyunok Oh The School of Electricl
More informationJournal of Graph Algorithms and Applications
Journl of Grph Algorithms nd Applictions http://www.cs.brown.edu/publictions/jg/ vol. 5, no. 5, pp. 17 38 (2001) New Bounds for Oblivious Mesh Routing Kzuo Iwm School of Informtics Kyoto University Kyoto
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationHVLearn: Automated Black-box Analysis of Hostname Verification in SSL/TLS Implementations
2017 IEEE Symposium on Security nd Privcy HVLern: Automted Blck-box Anlysis of Hostnme Verifiction in SSL/TLS Implementtions Suphnnee Sivkorn, George Argyros, Kexin Pei, Angelos D. Keromytis, nd Sumn Jn
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationL. Yaroslavsky. Fundamentals of Digital Image Processing. Course
L. Yroslvsky. Fundmentls of Digitl Imge Processing. Course 0555.330 Lecture. Imge enhncement.. Imge enhncement s n imge processing tsk. Clssifiction of imge enhncement methods Imge enhncement is processing
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More informationCHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE
CHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE 3.1 Scheimpflug Configurtion nd Perspective Distortion Scheimpflug criterion were found out to be the best lyout configurtion for Stereoscopic PIV, becuse
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationAn Integrated Simulation System for Human Factors Study
An Integrted Simultion System for Humn Fctors Study Ying Wng, Wei Zhng Deprtment of Industril Engineering, Tsinghu University, Beijing 100084, Chin Foud Bennis, Dmien Chblt IRCCyN, Ecole Centrle de Nntes,
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationCompatibility Testing - A Must Do of the Web Apps. By Premalatha Shanmugham & Kokila Elumalai
Comptibility Testing - A Must Do of the Web Apps By Premlth Shnmughm & Kokil Elumli Agend The Need The Impct The Chllenges The Strtegy The Checklist Metrics Inferences The Rod Ahed 2 2012 Indium Softwre
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationTool Vendor Perspectives SysML Thus Far
Frontiers 2008 Pnel Georgi Tec, 05-13-08 Tool Vendor Perspectives SysML Thus Fr Hns-Peter Hoffmnn, Ph.D Chief Systems Methodologist Telelogic, Systems & Softwre Modeling Business Unit Peter.Hoffmnn@telelogic.com
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationLECT-10, S-1 FP2P08, Javed I.
A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08
More informationParallel Square and Cube Computations
Prllel Squre nd Cube Computtions Albert A. Liddicot nd Michel J. Flynn Computer Systems Lbortory, Deprtment of Electricl Engineering Stnford University Gtes Building 5 Serr Mll, Stnford, CA 945, USA liddicot@stnford.edu
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationRevisiting the notion of Origin-Destination Traffic Matrix of the Hosts that are attached to a Switched Local Area Network
Interntionl Journl of Distributed nd Prllel Systems (IJDPS) Vol., No.6, November 0 Revisiting the notion of Origin-Destintion Trffic Mtrix of the Hosts tht re ttched to Switched Locl Are Network Mondy
More information9 Graph Cutting Procedures
9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationPerspectives: Improving SSH-style Host Authentication with Multi-Path Probing
Perspectives: Improving SSH-style Host Auntiction with Multi-Pth Probing Dn Wendlndt Dvid G. Andersen Adrin Perrig Crnegie Mellon University Abstrct The populrity Trust-on-first-use (Tu) untiction, used
More informationIntegration. October 25, 2016
Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationData Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.
Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized
More informationIZT DAB ContentServer, IZT S1000 Testing DAB Receivers Using ETI
IZT DAB ContentServer, IZT S1000 Testing DAB Receivers Using ETI Appliction Note Rel-time nd offline modultion from ETI files Generting nd nlyzing ETI files Rel-time interfce using EDI/ETI IZT DAB CONTENTSERVER
More information