The Search for Optimality in Automated Intrusion Response

Size: px
Start display at page:

Download "The Search for Optimality in Automated Intrusion Response"

Transcription

1 The Serch for Optimlity in Automted Intrusion Response Yu-Sung Wu nd Surbh Bgchi (DCSL) & The Center for Eduction nd Reserch in Informtion Assurnce nd Security (CERIAS) School of Electricl nd Computer Engineering Purdue University Work supported by: Purdue Reserch Foundtion, Avy, CERIAS Slide 1/20 Survivble Systems nd Intrusion Response Modern life hevily depends on computer systems Intrusions/security breches to these systems occur Wys to mke system survivble At design/implementtion phse Eliminte vulnerbilities Policy/Access Control/Cryptogrphy/Forml Verifiction In production phse Use IDS (system logs checking/network pcket sniffing/virus, worms scnning, detecting files modifictions ) to identify misuses/nomlies Perform incident/intrusion response (IRS) to detected misuses/nomlies Continment nd Recovery Focus of this work Slide 2/20

2 Intrusion Response System The need for IRS A survivble system needs to provide functionlity through intrusions Humn intervention fter IDS lert cn be costly nd slow IRS tkes reports from IDS (usully bundled together), processes it, nd crries out ctions to counter the intrusion Existing exmples of IRS Anti-virus softwre which disbles ccess to worm executbles or files infected with virus Routers/firewlls which ctively block worm trffic Lptops equipped with motion sensor nd TPM module tht cn lock up the computer when unuthorized movement (usully occurs when the lptop is being stolen) is detected Slide 3/20 Intrusion Response System Summry on existing IRS Most of them re stnd-lone nd re tied with one single nd specific detector (IDS) Trget mostly t one mchine box only IRS for Distributed Systems An environment of multiple interconnected boxes with heterogeneous nd cooperting services Few generl-purpose IRS solutions exist for distributed systems The most common wy is to use the stnd-lone solutions seprtely nd independently on the boxes E.g., Hve McAfee nti-virus softwre instlled on the worksttion boxes, nd CISCO IPS on the network joints. Slide 4/20

3 IRS for Distributed Systems Drwbck of the common wy Ech IRS/IDS pir does not leverge the detection reports from the other IDSs Existing reserch on correltion IDS hve shown cler dvntges of doing so The IRS/IDS pir does not consider the effects from the response ctions crried out by the other IRS/IDS pirs This cn led to redundnt response ctions nd denil-of-service of the system t worst. At best, loclly optiml decisions from ech IRS/IDS pir There is no gurntee of system-wide globl optimlity Slide 5/20 ADEPTS IRS: Bsics Specificlly designed for distributed systems Use I-GRAPH ( vrint of ttck grph) s the core binding between detectors (stnd-lone IDSs) nd response ctions (stndlone IRSs) A detector is ssocited with n I- GRAPH node to tell the confidence index of tht node being compromised The compromise confidence index of nodes without ssocited detectors cn be inferred through the grph structure Response ctions re ssocited with edges A response is ment to stop the progression of the intrusion from the source node to the destintion node OR n QUORUM AND 3. Illegl ccess to http document root Detector D Response X 12. Execute rbitrry code on MySQL host 1. SSL module buffer overflow in Apche host 1 Detector A 2.Execute rbitrry code on Apche host MySQL informtion lek Detector B 9. MySQL buffer overflow Response Y 4. Send mlicious chunk encoded pcket 10. DoS of MySQL 2 7. DoS of Apche host 1 6. Chunk hndling buffer overflow on Apche host DoS webstore Detector C 8. DoS of Apche host 2 5. C librry code buffer overflowed Response Z Slide 6/20

4 Attck Phses The dynmics between intrusion nd response v b w c f y d h I-GRAPH X Y d Z d h b b c b c R f X R Y R Z Assuming n ttck includes three snpshots X, Y, nd Z clled ttck phses Ech snpshot includes I-GRAPH nodes which hve been chieved s prt of the ttck thus fr Following ech snpshot k, ADEPTS determines set of response ctions R k for deployment Slide 7/20 Dignosis of Achieved I-GRAPH Nodes Responses in I-GRAPH Detector X A.C. = 1 Mlwre downloded to stff computer CCI = 1 e.p.p = e.p.p = 0.8 Detector Y 0.8 A.C. = 0.6 Pssword Chnge keystroke grdes r recorded x r y recorded CCI = 0.16 CCI = 0.33 Assume: Prob(r x fils) = 0.2 Prob(r y fils) = 0.4 For n edge e connecting node to b in I-GRAPH with response r : cci() Prob(r fils) epp(e), if b hs no detector cci(b) = [ cci() Prob(r fils) epp(e) + AC(x) ], if b hs detector x 2 epp(e) : The edge propgtion probbility of edge e. This models n dversry s likelihood of tking this edge ADEPTS deploys responses on the ttck phse bsed on the CCI vlue of node Slide 8/20

5 Impct Vector A system hs trnsction gols nd security gols tht it needs to meet through the time of opertion Exmple: providing e-mil service nd ensuring the confidentility of sensitive dt Attcks re ment to impct some of these gols Deployed responses lso impct some of these gols Assume the impct from n ttck to the system cn be quntified through vector IV with ech element in the IV corresponding to the impct on ech trnsction/security gol [0, 1] Impct vector for dversry reching I-GRAPH node n k is IV(n k ) Impct vector for response r k is IV(r k ) Slide 9/20 Optimlity of Response Actions We formlly define the cost for response combintion ( set of response ctions) RC i s: m n i = i = k k + k k= 1 k= 1 Cost( RC ) Iv( RC ) Iv( n )Prob( n ) Iv( r ) In our ttck grph model, Prob(n k ) is estimted s CCI(n k ) Accurtely speking, Prob(n k ) is conditioned on mny fctors, nd determining its vlue is by itself chllenging reserch problem The response combintion RC i is sid to be optiml for the given ttck if it chieves minimum Cost(RC i ) Slide 10/20

6 Types of Response Actions Given snpshot s nd I-GRAPH G In terms of continment, ADEPTS should consider ll response ctions pplicble to the grph (G-s) In terms of recovery, ADEPTS should consider ll response ctions pplicble to the grph s s is typiclly not huge, s its size is liner in the number of detectble steps in multi-stge ttck But (G-s) cn be huge A function of pplicble ttck steps (vulnerbilities) in ll services in the ppliction system However, for nodes in (G-s) which re fr wy from s, the likelihood of them being reched is lower thn for closer ones Slide 11/20 Domin Grph Our solution is to limit the response serch spce for snpshot s to subset of (G-s), nmely the domin grph D(s) D(s) includes criticl nodes from I-GRAPH A node n is criticl if CCI n *IV n is greter thn given threshold The current snpshot S (chieved ttck stges) b c f d e k g j h i Domin Grph D(S) : chieved : non-chieved / criticl : non-chieved / non-criticl Slide 12/20

7 Approximte O.R.D. with Genetic Algorithm Optiml Response Determintion is proved to be NPhrd by mpping the Set Covering Problem to it The current snpshot S (chieved ttck stges) Encode the set R of responses pplicble within D(S) into chromosomes; Fitness of chromosome relted to cost b c f Apply Genetic Algorithm Solver: Crossover/Muttion/ Elitism Preserve the top chromosomes for future ttcks tht hve similr snpshots s s d e k g j h i Domin Grph D(S) : chieved : non-chieved / criticl : non-chieved / non-criticl Pick the best chromosome (the best response combintion) s the pproximte solution to ORD. Slide 13/20 Genetic Algorithm bsed Solver for ORD Why choose G.A.? Derivtive bsed optimiztion techniques do not work s our objective function is discrete Since exct problem is NP-hrd, one hs to look for pproximte serch Trde-off between the optimlity of the solutions nd the computtionl expense is djustble by controlling the size of the domin grph nd the number of evolutions in the GA bsed solver Good solutions (response combintions) from previous instnces re preserved into the chromosome popultion for future instnces of similr ttcks This speeds up the serch of good response combintions for future ttcks which re similr to the current one Slide 14/20

8 Experiment nd preliminry results The testbed A three-tier ecommerce system s the reference bsis for constructing ttck scenrios. Apche Tomct Apche Lod Blncer IPTbles Apche Tomct JBoss AS Jv PetStore Controller JBoss AS Jv PetStore Components MySQL A drone bsed testing frmework RESPONSE MESSAGES ATTACK MESSAGE Slide 15/20 Experiment nd Preliminry results Attck scenrios 0.C Ping or trceroute to web servers 2.A Exploit ssldump vuln. on web server 3.A Copy hcker tool to web svr using tftp 1.C Run portscnner on web servers 2.B.1 Access web server dmin site 2.B.2 Brute force dmin pssword 3.B Instll vuln. scnner on web svr Attck scenrios 3 nd 4, used for experimentl evlution. Boxes with A nd B denote the stges for scenrio 3 nd 4 respectively, while C denotes stges common to both. 5.A Exploit rpc.sttd service on pp controller 4.C Run port scnner on internl network 6.A Brute force root pwd on pp controller 6.B Exploit remote vuln. on MySQL 7.C Run MySQL modifiction queries on dtbse tbles Slide 16/20

9 Experiment Comprison ginst Bseline ADEPTS vs. the bseline (loclly optimized responses) Attck Scenrio 3 8 Survivbility ADEPTS Bseline ADEPTS Number of itertions Slide 17/20 Experiment Incorrect Initil Conditions ADEPTS where initil settings (effectiveness of responses, IV vlues, etc.) re incorrect, sy due to inexperienced sysdmin Attck Scenrio Survivbility ADEPTS Bseline ADEPTS Number of itertions After 16 itertions of the ttck, the effect of incorrect initil prmeters disppers Slide 18/20

10 Experiment Lerning from Similrity Utilizing the informtion (chromosomes) from similr ttcks Attck Scenrio 4 nd vrint Attck Scenrio Survivbility AS4 with history AS4 without history Number of itertions For one cse, AS4 is run fter running its vrint AS3 nd generting history. For the other, AS4 is run without such history. It tkes 8 itertions for the ltter to ctch up. Slide 19/20 Wrp-up Defined frmework to reson bout optimlity of intrusion responses in distributed systems The frmework is implemented using genetic lgorithm bsed solver since exct solution is NP-hrd Experiments with rel multi-stge ttcks indicte tht globlly optimizing response choices is beneficil Wht s coming next: How cn the number of evolutions of the GA be determined? Wht hppens if some detectors re misconfigured nd ttck phses re incomplete? How to hndle incomplete I-GRAPHs? Slide 20/20

Encoding techniques for evading n-gram based Intrusion Detection Systems

Encoding techniques for evading n-gram based Intrusion Detection Systems Encoding techniques for evding n-grm bsed Intrusion Detection Systems Studienrbeit Moritz Bechler moritz.bechler@student.uni-tuebingen.de Universität Tübingen Wilhelm Schickrd Institut SPRING 7 5.7.2012

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Elena Baralis, Silvia Chiusano Politecnico di Torino. Pag. 1. Query optimization. DBMS Architecture. Query optimizer. Query optimizer.

Elena Baralis, Silvia Chiusano Politecnico di Torino. Pag. 1. Query optimization. DBMS Architecture. Query optimizer. Query optimizer. DBMS Architecture SQL INSTRUCTION OPTIMIZER Dtbse Mngement Systems MANAGEMENT OF ACCESS METHODS BUFFER MANAGER CONCURRENCY CONTROL RELIABILITY MANAGEMENT Index Files Dt Files System Ctlog DATABASE 2 Query

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

Transparent neutral-element elimination in MPI reduction operations

Transparent neutral-element elimination in MPI reduction operations Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Looking up objects in Pastry

Looking up objects in Pastry Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

Enginner To Engineer Note

Enginner To Engineer Note Technicl Notes on using Anlog Devices DSP components nd development tools from the DSP Division Phone: (800) ANALOG-D, FAX: (781) 461-3010, EMAIL: dsp_pplictions@nlog.com, FTP: ftp.nlog.com Using n ADSP-2181

More information

ISG: Itemset based Subgraph Mining

ISG: Itemset based Subgraph Mining ISG: Itemset bsed Subgrph Mining by Lini Thoms, Stynryn R Vlluri, Kmlkr Krlplem Report No: IIIT/TR/2009/179 Centre for Dt Engineering Interntionl Institute of Informtion Technology Hyderbd - 500 032, INDIA

More information

On Computation and Resource Management in Networked Embedded Systems

On Computation and Resource Management in Networked Embedded Systems On Computtion nd Resource Mngement in Networed Embedded Systems Soheil Ghisi Krlene Nguyen Elheh Bozorgzdeh Mjid Srrfzdeh Computer Science Deprtment University of Cliforni, Los Angeles, CA 90095 soheil,

More information

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

DQL: A New Updating Strategy for Reinforcement Learning Based on Q-Learning

DQL: A New Updating Strategy for Reinforcement Learning Based on Q-Learning DQL: A New Updting Strtegy for Reinforcement Lerning Bsed on Q-Lerning Crlos E. Mrino 1 nd Edurdo F. Morles 2 1 Instituto Mexicno de Tecnologí del Agu, Pseo Cuhunáhuc 8532, Jiutepec, Morelos, 6255, MEXICO

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

USING HOUGH TRANSFORM IN LINE EXTRACTION

USING HOUGH TRANSFORM IN LINE EXTRACTION Stylinidis, Efstrtios USING HOUGH TRANSFORM IN LINE EXTRACTION Efstrtios STYLIANIDIS, Petros PATIAS The Aristotle University of Thessloniki, Deprtment of Cdstre Photogrmmetry nd Crtogrphy Univ. Box 473,

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Migrating vrealize Automation to 7.3 or March 2018 vrealize Automation 7.3

Migrating vrealize Automation to 7.3 or March 2018 vrealize Automation 7.3 Migrting vrelize Automtion to 7.3 or 7.3.1 15 Mrch 2018 vrelize Automtion 7.3 You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/ If you hve comments bout

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Digital Design. Chapter 6: Optimizations and Tradeoffs

Digital Design. Chapter 6: Optimizations and Tradeoffs Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

Ensuring PCI DSS Compliance with the Mist Learning WLAN THE SAFE CHOICE FOR MISSION CRITICAL WIRELESS NETWORKS IN PCI ENVIRONMENTS

Ensuring PCI DSS Compliance with the Mist Learning WLAN THE SAFE CHOICE FOR MISSION CRITICAL WIRELESS NETWORKS IN PCI ENVIRONMENTS Ensuring PCI DSS Complince with the Mist Lerning WLAN THE SAFE CHOICE FOR MISSION CRITICAL WIRELESS NETWORKS IN PCI ENVIRONMENTS Tble of Contents Ensuring PCI DSS Complince with the Mist Lerning WLAN...

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

Efficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc

Efficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc 4th Ntionl Conference on Electricl, Electronics nd Computer Engineering (NCEECE 2015) Efficient Regulr Expression Grouping Algorithm Bsed on Lbel Propgtion Xi Chen, Shuqio Chenb nd Ming Moc Ntionl Digitl

More information

Fault injection attacks on cryptographic devices and countermeasures Part 2

Fault injection attacks on cryptographic devices and countermeasures Part 2 Fult injection ttcks on cryptogrphic devices nd countermesures Prt Isrel Koren Deprtment of Electricl nd Computer Engineering University of Msschusetts Amherst, MA Countermesures - Exmples Must first detect

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

An Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization

An Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction

More information

A Heuristic Approach for Discovering Reference Models by Mining Process Model Variants

A Heuristic Approach for Discovering Reference Models by Mining Process Model Variants A Heuristic Approch for Discovering Reference Models by Mining Process Model Vrints Chen Li 1, Mnfred Reichert 2, nd Andres Wombcher 3 1 Informtion System Group, University of Twente, The Netherlnds lic@cs.utwente.nl

More information

Chapter Spline Method of Interpolation More Examples Electrical Engineering

Chapter Spline Method of Interpolation More Examples Electrical Engineering Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.

More information

CS 268: IP Multicast Routing

CS 268: IP Multicast Routing Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X 4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

A Formalism for Functionality Preserving System Level Transformations

A Formalism for Functionality Preserving System Level Transformations A Formlism for Functionlity Preserving System Level Trnsformtions Smr Abdi Dniel Gjski Center for Embedded Computer Systems UC Irvine Center for Embedded Computer Systems UC Irvine Irvine, CA 92697 Irvine,

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

II. THE ALGORITHM. A. Depth Map Processing

II. THE ALGORITHM. A. Depth Map Processing Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A

More information

McAfee Network Security Platform

McAfee Network Security Platform NTBA Applince T-200 nd T-500 Quick Strt Guide Revision B McAfee Network Security Pltform 1 Instll the mounting rils Position the mounting rils correctly nd instll them t sme levels. At the front of the

More information

Text mining: bag of words representation and beyond it

Text mining: bag of words representation and beyond it Text mining: bg of words representtion nd beyond it Jsmink Dobš Fculty of Orgniztion nd Informtics University of Zgreb 1 Outline Definition of text mining Vector spce model or Bg of words representtion

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

EECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining

EECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining EECS150 - Digitl Design Lecture 23 - High-level Design nd Optimiztion 3, Prllelism nd Pipelining Nov 12, 2002 John Wwrzynek Fll 2002 EECS150 - Lec23-HL3 Pge 1 Prllelism Prllelism is the ct of doing more

More information

Functor (1A) Young Won Lim 10/5/17

Functor (1A) Young Won Lim 10/5/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

vcloud Director Service Provider Admin Portal Guide vcloud Director 9.1

vcloud Director Service Provider Admin Portal Guide vcloud Director 9.1 vcloud Director Service Provider Admin Portl Guide vcloud Director 9. vcloud Director Service Provider Admin Portl Guide You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/

More information

Functor (1A) Young Won Lim 8/2/17

Functor (1A) Young Won Lim 8/2/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

vcloud Director Service Provider Admin Portal Guide 04 OCT 2018 vcloud Director 9.5

vcloud Director Service Provider Admin Portal Guide 04 OCT 2018 vcloud Director 9.5 vcloud Director Service Provider Admin Portl Guide 04 OCT 208 vcloud Director 9.5 You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/ If you hve comments

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

Evolutionary Approaches To Minimizing Network Coding Resources

Evolutionary Approaches To Minimizing Network Coding Resources This full text pper ws peer reviewed t the direction of IEEE Communictions Society suject mtter experts for puliction in the IEEE INFOCOM 2007 proceedings. Evolutionry Approches To Minimizing Network Coding

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Memory-Optimized Software Synthesis from Dataflow Program Graphs withlargesizedatasamples

Memory-Optimized Software Synthesis from Dataflow Program Graphs withlargesizedatasamples EURSIP Journl on pplied Signl Processing 2003:6, 54 529 c 2003 Hindwi Publishing orportion Memory-Optimized Softwre Synthesis from tflow Progrm Grphs withlrgesizetsmples Hyunok Oh The School of Electricl

More information

Journal of Graph Algorithms and Applications

Journal of Graph Algorithms and Applications Journl of Grph Algorithms nd Applictions http://www.cs.brown.edu/publictions/jg/ vol. 5, no. 5, pp. 17 38 (2001) New Bounds for Oblivious Mesh Routing Kzuo Iwm School of Informtics Kyoto University Kyoto

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

HVLearn: Automated Black-box Analysis of Hostname Verification in SSL/TLS Implementations

HVLearn: Automated Black-box Analysis of Hostname Verification in SSL/TLS Implementations 2017 IEEE Symposium on Security nd Privcy HVLern: Automted Blck-box Anlysis of Hostnme Verifiction in SSL/TLS Implementtions Suphnnee Sivkorn, George Argyros, Kexin Pei, Angelos D. Keromytis, nd Sumn Jn

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

L. Yaroslavsky. Fundamentals of Digital Image Processing. Course

L. Yaroslavsky. Fundamentals of Digital Image Processing. Course L. Yroslvsky. Fundmentls of Digitl Imge Processing. Course 0555.330 Lecture. Imge enhncement.. Imge enhncement s n imge processing tsk. Clssifiction of imge enhncement methods Imge enhncement is processing

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

CHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE

CHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE CHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE 3.1 Scheimpflug Configurtion nd Perspective Distortion Scheimpflug criterion were found out to be the best lyout configurtion for Stereoscopic PIV, becuse

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

Phylogeny and Molecular Evolution

Phylogeny and Molecular Evolution Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion

More information

An Integrated Simulation System for Human Factors Study

An Integrated Simulation System for Human Factors Study An Integrted Simultion System for Humn Fctors Study Ying Wng, Wei Zhng Deprtment of Industril Engineering, Tsinghu University, Beijing 100084, Chin Foud Bennis, Dmien Chblt IRCCyN, Ecole Centrle de Nntes,

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Compatibility Testing - A Must Do of the Web Apps. By Premalatha Shanmugham & Kokila Elumalai

Compatibility Testing - A Must Do of the Web Apps. By Premalatha Shanmugham & Kokila Elumalai Comptibility Testing - A Must Do of the Web Apps By Premlth Shnmughm & Kokil Elumli Agend The Need The Impct The Chllenges The Strtegy The Checklist Metrics Inferences The Rod Ahed 2 2012 Indium Softwre

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

Tool Vendor Perspectives SysML Thus Far

Tool Vendor Perspectives SysML Thus Far Frontiers 2008 Pnel Georgi Tec, 05-13-08 Tool Vendor Perspectives SysML Thus Fr Hns-Peter Hoffmnn, Ph.D Chief Systems Methodologist Telelogic, Systems & Softwre Modeling Business Unit Peter.Hoffmnn@telelogic.com

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

LECT-10, S-1 FP2P08, Javed I.

LECT-10, S-1 FP2P08, Javed I. A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08

More information

Parallel Square and Cube Computations

Parallel Square and Cube Computations Prllel Squre nd Cube Computtions Albert A. Liddicot nd Michel J. Flynn Computer Systems Lbortory, Deprtment of Electricl Engineering Stnford University Gtes Building 5 Serr Mll, Stnford, CA 945, USA liddicot@stnford.edu

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Revisiting the notion of Origin-Destination Traffic Matrix of the Hosts that are attached to a Switched Local Area Network

Revisiting the notion of Origin-Destination Traffic Matrix of the Hosts that are attached to a Switched Local Area Network Interntionl Journl of Distributed nd Prllel Systems (IJDPS) Vol., No.6, November 0 Revisiting the notion of Origin-Destintion Trffic Mtrix of the Hosts tht re ttched to Switched Locl Are Network Mondy

More information

9 Graph Cutting Procedures

9 Graph Cutting Procedures 9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Perspectives: Improving SSH-style Host Authentication with Multi-Path Probing

Perspectives: Improving SSH-style Host Authentication with Multi-Path Probing Perspectives: Improving SSH-style Host Auntiction with Multi-Pth Probing Dn Wendlndt Dvid G. Andersen Adrin Perrig Crnegie Mellon University Abstrct The populrity Trust-on-first-use (Tu) untiction, used

More information

Integration. October 25, 2016

Integration. October 25, 2016 Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved. Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized

More information

IZT DAB ContentServer, IZT S1000 Testing DAB Receivers Using ETI

IZT DAB ContentServer, IZT S1000 Testing DAB Receivers Using ETI IZT DAB ContentServer, IZT S1000 Testing DAB Receivers Using ETI Appliction Note Rel-time nd offline modultion from ETI files Generting nd nlyzing ETI files Rel-time interfce using EDI/ETI IZT DAB CONTENTSERVER

More information