Balanced Trees. 2-3 trees red-black trees B-trees. 2-3 trees red-black trees B-trees smaller than. 2-node. 3-node E J S X A C.
|
|
- Olivia Austin
- 6 years ago
- Views:
Transcription
1 ymol tle review Blned Trees implementtion gurntee verge se serh insert delete serh hit insert delete ordered itertion? opertions on keys sequentil serh (linked list) N N N N/2 N N/2 no equls() 2-3 trees red-lk trees B-trees inry serh (ordered rry) lg N N N lg N N/2 N/2 yes ompreto() BT N N N 1.39 lg N 1.39 lg N? yes ompreto() Gol log N log N log N log N log N log N yes ompreto() eferenes: ndout on red-lk trees lgorithms in Jv, 4 th dition oert edgewik nd Kevin Wyne opyright 2008 Otoer 13, :17:08 hllenge. Gurntee performne. This leture. 2-3 trees, left-lening red-lk trees, B-trees. introdued to the world in O 226, Fll 2007 (see hndout) tree llow 1 or 2 keys per node. 2-node: one key, two hildren. 3-node: two keys, three hildren. ymmetri order. Inorder trversl yields keys in sending order. erfet lne. very pth from root to null link hs sme length. 2-3 trees red-lk trees B-trees smller thn 3-node J lrger thn J 2-node nd J null link 3 4
2 erh in 2-3 tree Insertion in 2-3 tree ompre serh key ginst keys in node. Find intervl ontining serh key. Follow ssoited link (reursively). se 1. Insert into 2-node t ottom. erh for key, s usul. eple 2-node with 3-node. suessful serh for unsuessful serh for B is thn so look to the left B is thn so look to the left inserting K J J J found so return vlue (serh hit) is nd so look in the middle J B is thn so look to the left B is nd so look in the middle link is null so B is not in the tree (serh miss) J J J J K serh for K ends here reple 2-node with new 3-node ontining K Insert into 2-node uessful nd unsuessful serh in 2-3 tree 5 6 Insertion in 2-3 tree Insertion in 2-3 tree se 2. Insert into 3-node t ottom. dd new key to 3-node to rete temporry 4-node. ove middle key in 4-node into prent. why middle key? inserting Z se 2. Insert into 3-node t ottom. dd new key to 3-node to rete temporry 4-node. ove middle key in 4-node into prent. epet up the tree, s neessry. J J J Z serh for Z ends t this 3-node reple 3-node with temporry 4-node ontining Z reple 2-node with new 3-node ontining middle key Z inserting D serh for D ends t this 3-node dd new key D to 3-node to mke temporry 4-node J D J dd middle key to 3-node to mke temporry 4-node J D split 4-node into two 2-nodes pss middle key to prent dd middle key to 2-node to mke new 3-node D J split 4-node into two 2-nodes pss middle key to prent split 4-node into two 2-nodes pss middle key to prent Insert into 3-node whose prent is 3-node 7 8
3 Insertion in 2-3 tree 2-3 tree onstrution tre se 2. Insert into 3-node t ottom. dd new key to 3-node to rete temporry 4-node. ove middle key in 4-node into prent. epet up the tree, s neessry. If you reh the root nd it's 4-node, split it into three 2-nodes. tndrd indexing lient. insert inserting D serh for D ends t this 3-node D J dd new key D to 3-node to mke temporry 4-node J dd middle key to 3-node to mke temporry 4-node split 4-node into two 2-nodes pss middle key to prent split 4-node into three 2-nodes inresing tree height y 1 J D J D insert insert emrk. plitting the root inreses height y tree onstrution tre The sme keys inserted in sending order. ol trnsformtions in 2-3 tree plitting 4-node is lol trnsformtion: onstnt numer of steps. insert e d thn thn nd nd nd nd e nd d nd d d nd e plitting 4-node is lol trnsformtion d d nd e greter thn e greter thn e stndrd indexing lient sme keys in inresing order 2-3 tree onstrution tres 11 12
4 Glol properties in 2-3 tree 2-3 tree: performne Invrint. ymmetri order. Invrint. erfet lne. erfet lne. very pth from root to null link hs sme length. f. h trnsformtion mintins order nd lne. left right d d prent is 2-node d d prent is 3-node left d e d e middle e d e d Tree height. Worst se: Best se: splitting the root right d e d e tree: performne T implementtions: summry erfet lne. very pth from root to null link hs sme length. implementtion gurntee verge se serh insert delete serh hit insert delete ordered itertion? opertions on keys sequentil serh (linked list) N N N N/2 N N/2 no equls() Tree height. Worst se: lg N. [ll 2-nodes] Best se: log 3 N.631 lg N. [ll 3-nodes] Between 12 nd 20 for million nodes. Between 18 nd 30 for illion nodes. Gurnteed logrithmi performne for serh nd insert. inry serh (ordered rry) lg N N N lg N N/2 N/2 yes ompreto() BT N N N 1.39 lg N 1.39 lg N? yes ompreto() 2-3 tree lg N lg N lg N lg N lg N lg N yes ompreto() onstnts depend upon implementtion 15 16
5 2-3 tree: implementtion? Diret implementtion is omplited, euse: intining multiple node types is umersome. Need multiple ompres to move down tree. Need to move k up the tree to split 4-nodes. rge numer of ses for splitting. Bottom line. ould do it, ut there's etter wy trees red-lk trees B-trees eft-lening red-lk trees (Guis-edgewik 1979 nd edgewik 2007) n equivlent definition 1. epresent 2 3 tree s BT. 2. Use "internl" left-lening links s "glue" for 3 nodes. 3-node thn nd greter thn thn nd noding 3-node with two 2-nodes greter thn lrger key is root BT suh tht: No node hs two red links onneted to it. very pth from root to null link hs the sme numer of lk links. ed links len left. "perfet lk lne" Key property. 1 1 orrespondene 2 3 nd B. 2-3 tree red lk tree J J lk links onnet 2-nodes nd 3-nodes red lk tree J red links "glue" nodes within 3-node 19 20
6 erh implementtion for red-lk trees ed-lk tree representtion Oservtion. erh is the sme s for elementry BT (ignore olor). ut runs fster euse of etter lne h node is pointed to y preisely one link (from its prent) n enode olor of links in nodes. puli Vl get(key key) Node x = root; while (x!= null) int mp = key.ompreto(x.key); if (mp < 0) x = x.left; else if (mp > 0) x = x.right; else if (mp == 0) return x.vl; return null; red lk tree J privte stti finl oolen D = true; privte stti finl oolen BK = flse; privte lss Node Key key; Vlue vl; Node left, right; oolen olor; privte oolen ised(node x) if (x == null) return flse; return x.olor == D; h.left.olor is D D h G J h.right.olor is BK null links re lk emrk. ny other ops (e.g., eiling, seletion, itertion) re lso identil lementry red-lk tree opertions lementry red-lk tree opertions eft rottion. Orient (temporrily) right-lening red link to len left. ight rottion. Orient left-lening red link to (temporrily) len right. h thn ould e right or left, red or lk nd Node rotteeft(node h) x greter thn return x; h thn nd eft rotte (right link of h) x greter thn x thn nd h greter thn x thn nd h greter thn privte Node rotteeft(node h) x = h.right; h.right = x.left; x.left = h; x.olor = h.olor; h.olor = D; return x; privte Node rotteight(node h) Node x = h.left; h.left = x.right; x.right = h; x.olor = h.olor; h.olor = D; return x; Invrints. intins symmetri order nd perfet lk lne. Invrints. intins symmetri order nd perfet lk lne
7 lementry red-lk tree opertions lementry red-lk tree opertions: exmples olor flip. eolor to split (temporry) 4-node. h ould e left or right link lk links split to 2-nodes red link tthes middle node to prent n red ors flip olors ed ht thn nd nd greter thn thn nd nd greter thn privte void flipolors(node h) h.olor = D; h.left.olor = BK; h.right.olor = BK; rotte left rotte right Invrints. intins symmetri order nd perfet lk lne Insertion in B tree: overview Insertion in B tree Bsi strtegy. intin 1-1 orrespondene with 2-3 trees y pplying elementry red-lk tree opertions. Wrmup 1. Insert into tree with extly 1 node. insert dd new node here rotte left left serh ends t this null link root root red link to new node ontining onverts 2-node to 3-node right root serh ends t this null link tthed new node with red link root rotted left to mke legl 3-node B tree 2-3 tree 27 28
8 Insertion in B tree Insertion in B tree Wrmup 2. Insert into tree with extly 2 nodes. ed lrger serh ends t this null link tthed new node with red link olors flipped to lk smller serh ends t this null link tthed new node with red link rotted right olors flipped to lk d serh ends t this null link tthed new node with red link rotted left rotted right l olors flipped to lk se 1. Insert into 2-node t the ottom. Do stndrd BT insert; olor new link red. If new red link is right link, rotte left. insert dd new node here right link red so rotte left Insertion in B tree Insertion in B tree se 2. Insert into 3-node t the ottom. Do stndrd BT insert; olor new link red. otte to lne the 4-node (if needed). Flip olors to pss red link up one level. otte to mke len left (if needed). insert dd new node here two lefts in row so rotte right oth hildren red right link red so rotte left oth hildren red so flip olors se 2. Insert into 3-node t the ottom. Do stndrd BT insert; olor new link red. otte to lne the 4-node (if needed). Flip olors to pss red link up one level. otte to mke len left (if needed). epet se 1 or se 2 up the tree (if needed). insert oth hildren red so flip olors right link red so rotte right dd new node here two lefts in row so rotte right oth hildren red so flip olors 31 two lefts in row so rotte right 32
9 B tree onstrution tre B tree onstrution tre tndrd indexing lient. tndrd indexing lient. insert insert red lk tree 2-3 tree stndrd indexing lient sme keys in inresing order red-lk tree onstrution tres red lk tree 2-3 tree Insertion in B tree: Jv implementtion Insertion in B tree: visuliztion me ode for oth ses. If the right hild is red nd the left hild is not red, rotte left. If oth the left hild nd its left hild re red, rotte right. If oth hildren re red, flip olors. privte Node put(node h, Key key, Vlue vl) if (h == null) return new Node(key, vl, D); int mp = key.ompreto(h.key); if (mp < 0) h.left = put(h.left, key, vl); else if (mp > 0) h.right = put(h.right, key, vl); else h.vl = vl; insert t ottom if (ised(h.right) &&!ised(h.left)) h = rotteeft(h); if (ised(h.left) && ised(h.left.left)) h = rotteight(h); if (ised(h.left) && ised(h.right)) h = flipolors(h); len left lne 4-node split 4-node 255 insertions in sending order return h; only few extr lines of ode provide ner-perfet lne 35 36
10 Insertion in B tree: visuliztion Insertion in B tree: visuliztion 255 insertions in desending order 50 rndom insertions Insertion in B tree: visuliztion Blne in B trees roposition. eight of tree is 2 lg N in the worst se. f. very pth from root to null link hs sme numer of lk links. Never two red links in--row. 255 rndom insertions roperty. eight of tree is ~ 1.00 lg N in typil pplitions
11 T implementtions: summry Why left-lening trees? implementtion sequentil serh (linked list) inry serh (ordered rry) gurntee verge se serh insert delete serh hit insert delete ordered itertion? opertions on keys N N N N/2 N N/2 no equls() lg N N N lg N N/2 N/2 yes ompreto() BT N N N 1.39 lg N 1.39 lg N? yes ompreto() 2-3 tree lg N lg N lg N lg N lg N lg N yes ompreto() red-lk tree 2 lg N 2 lg N 2 lg N 1.00 lg N 1.00 lg N 1.00 lg N yes ompreto() ext vlue of oeffiient unknown ut extremely lose to 1 old ode (tht students hd to lern in the pst) privte Node put(node x, Key key, Vlue vl, oolen sw) if (x == null) return new Node(key, vlue, D); int mp = key.ompreto(x.key); if (ised(x.left) && ised(x.right)) x.olor = D; x.left.olor = BK; x.right.olor = BK; if (mp < 0) x.left = put(x.left, key, vl, flse); if (ised(x) && ised(x.left) && sw) x = rotteight(x); if (ised(x.left) && ised(x.left.left)) x = rotteight(x); x.olor = BK; x.right.olor = D; else if (mp > 0) x.right = put(x.right, key, vl, true); if (ised(h) && ised(x.right) &&!sw) x = rotteeft(x); if (ised(h.right) && ised(h.right.right)) x = rotteeft(x); x.olor = BK; x.left.olor = D; else x.vl = vl; return x; new ode (tht you hve to lern) puli Node put(node h, Key key, Vlue vl) if (h == null) return new Node(key, vl, D); int mp = kery.ompreto(h.key); if (mp < 0) h.left = put(h.left, key, vl); else if (mp > 0) h.right = put(h.right, key, vl); else h.vl = vl; if (ised(h.right) &&!ised(h.left)) h = rotteeft(h); if (ised(h.left) && ised(h.left.left)) h = rotteight(h); if (ised(h.left) && ised(h.right)) h = flipolors(h); return h; extremely triky strightforwrd (if you ve pid ttention) Why left-lening trees? implified ode. eft-lening restrition redues numer of ses. hort inner loop. me ides simplify implementtion of other opertions. Delete min/mx. ritrry delete. Improves widely-used lgorithms. V trees, 2-3 trees, trees. ed-lk trees. new trees red-lk trees B-trees Bottom line. eft-lening red-lk trees re the simplest lned BT to implement nd the fstest in prtie
12 File system model B-trees (Byer-reight, 1972) ge. ontiguous lok of dt (e.g., file or 4096-yte hunk). roe. First ess to pge (e.g., from disk to memory). B-tree. Generlize 2-3 trees y llowing up to links per node. t lest 1 entry t root. t lest /2 links in other nodes. xternl nodes ontin lient keys. Internl nodes ontin opies of keys to guide serh. hoose s lrge s possile so tht links fit in pge, e.g., = 1000 slow fst * K 2-node odel. Time required for proe is muh lrger thn time to essdt within pge. Gol. ess dt using minimum numer of proes. * B sentinel key * D 5-node (full) D F I J K N O Q T lient keys (lk) re in externl nodes eh red key is opy of min key in sutree ntomy of B-tree set ( = 5) K Q U internl node U W externl node ll nodes exept the root re 3-, 4- or 5-nodes erhing in B-tree Insertion in B-tree trt t root. Find intervl for serh key nd tke orresponding link. erh termintes in externl node. erh for new key. Insert t ottom. plit (+1)-nodes on the wy up the tree. inserting * K Q U * B F I J K N O Q T U W serhing for * B follow this link euse is * nd K serh for in this externl node * D * K follow this link euse is D nd K Q U D F I J K N O Q T U W * B F I J K N O Q T U W new key () uses overflow nd split * * K Q U * K Q U * B F I J K N O Q T U W * K root split uses new root to e reted new key () uses overflow nd split K Q U * B F I J K N O Q T U W 47 48
13 Blne in B-tree Blned trees in the wild roes. serh or insert in B-tree of order with N items requires log N nd log /2N proes. f. ll internl nodes (esides root) hve /2 nd links. ed-lk trees re widely used s system symol tles. Jv: jv.util.treep, jv.util.treeet. ++ T: mp, multimp, multiset. inux kernel: ompletely fir sheduler, linux/rtree.h. In prtie. Numer of proes is t most 4! Optimiztion. lwys keep root pge in memory. = 1000; N = 62 illion log /2 N 4 B-tree vrints. B+ tree, B*tree, B# tree, B-trees (nd vrints) re widely used for file systems nd dtses. Windows: F. : F, F+. inux: eiserf, F, xt3f, JF. Dtses: O, DB2, ING, Q, ostgreq ed-lk trees in the wild ed-lk trees in the wild ommon sense. ixth sense. Together they're the FBI's newest tem
2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationimplementation sequential search (unordered list) binary search (ordered array) BST N N N log N log N N compareto()
OBT DGWIK KVIN WYN lgorithms OBT DGWIK KVIN WYN ymol tle review lgorithms F O U T D I T I O N http://lgs4.s.prineton.edu 3.3 BND T 2 3 serh trees red lk BTs B-trees implementtion sequentil serh (unordered
More information4.3 Balanced Trees. let us assume that we can manipulate them conveniently and see how they can be put together to form trees.
428 T FOU 4.3 Blned Trees T BT GOIT IN T VIOU setion work well for wide vriety of pplitions, ut they hve poor worst-se performne. s we hve noted, files lredy in order, files in reverse order, files with
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationAlgorithms. Algorithms 3.3 BALANCED SEARCH TREES. 2 3 search trees red black BSTs B-trees (see book or videos) ROBERT SEDGEWICK KEVIN WAYNE
lgorithms OBT DGWICK KVIN WYN 3.3 BLNCD C T lgorithms F O U T D I T I O N 2 3 search trees red black BTs B-trees (see book or videos) OBT DGWICK KVIN WYN http://algs4.cs.princeton.edu Last updated on 10/17/17
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationAlgorithms. Algorithms 3.3 BALANCED SEARCH TREES. 2 3 search trees red black BSTs ROBERT SEDGEWICK KEVIN WAYNE.
lgorithms OBT DGWICK KVIN WYN 3.3 BLNCD C T 2 3 search trees red black BTs lgorithms F O U T D I T I O N OBT DGWICK KVIN WYN http://algs4.cs.princeton.edu Last updated on 10/11/16 9:22 M BT: ordered symbol
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationAdvanced Programming Handout 5. Enter Okasaki. Persistent vs. Ephemeral. Functional Queues. Simple Example. Persistent vs.
Avne Progrmming Hnout 5 Purel Funtionl Dt Strutures: A Cse Stu in Funtionl Progrmming Persistent vs. Ephemerl An ephemerl t struture is one for whih onl one version is ville t time: fter n upte opertion,
More informationCOMP108 Algorithmic Foundations
Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More informationDistance vector protocol
istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationContainers: Queue and List
Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of
More informationCOMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.
COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those
More informationLecture 13: Graphs I: Breadth First Search
Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationShared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion
Tody s Outline Arhitetures Progrmming nd Synhroniztion Disuss pper on Cosmi Cube (messge pssing) Messge pssing review Cosmi Cube disussion > Messge pssing mhine Shred memory model > Communition > Synhroniztion
More informationOutline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP
ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression
More informationMidterm Exam CSC October 2001
Midterm Exm CSC 173 23 Otoer 2001 Diretions This exm hs 8 questions, severl of whih hve suprts. Eh question indites its point vlue. The totl is 100 points. Questions 5() nd 6() re optionl; they re not
More informationIntroduction to Algebra
INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationCOSC 6374 Parallel Computation. Dense Matrix Operations
COSC 6374 Prllel Computtion Dense Mtrix Opertions Edgr Griel Fll Edgr Griel Prllel Computtion Edgr Griel erminology Dense Mtrix: ll elements of the mtrix ontin relevnt vlues ypilly stored s 2-D rry, (e.g.
More informationInternet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
More informationCan Pythagoras Swim?
Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationChapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More informationMinimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationParallelization Optimization of System-Level Specification
Prlleliztion Optimiztion of System-Level Speifition Luki i niel. Gjski enter for Emedded omputer Systems University of liforni Irvine, 92697, US {li, gjski} @es.ui.edu strt This pper introdues the prlleliztion
More informationChapter 4 Fuzzy Graph and Relation
Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,
More informationError Numbers of the Standard Function Block
A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution
More informationLecture 12 : Topological Spaces
Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X
More informationCS453 INTRODUCTION TO DATAFLOW ANALYSIS
CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register
More informationCalculus Differentiation
//007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationGENG2140 Modelling and Computer Analysis for Engineers
GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationDuality in linear interval equations
Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny
More informationProblem Final Exam Set 2 Solutions
CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationCOMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA:
In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationType Checking. Roadmap (Where are we?) Last lecture Context-sensitive analysis. This lecture Type checking. Symbol tables
Type Cheking Rodmp (Where re we?) Lst leture Contet-sensitie nlysis Motition Attriute grmmrs Ad ho Synt-direted trnsltion This leture Type heking Type systems Using synt direted trnsltion Symol tles Leil
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationFEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model.
Introutory Eonometris: A Moern Approh 6th Eition Woolrige Test Bnk Solutions Complete ownlo: https://testbnkre.om/ownlo/introutory-eonometris-moern-pproh-6th-eition-jeffreym-woolrige-test-bnk/ Solutions
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationClass Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414
Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationComputational geometry
Leture 23 Computtionl geometry Supplementl reding in CLRS: Chpter 33 exept 33.3 There re mny importnt prolems in whih the reltionships we wish to nlyze hve geometri struture. For exmple, omputtionl geometry
More informationString comparison by transposition networks
String omprison y trnsposition networks Alexnder Tiskin (Joint work with Peter Krushe) Deprtment of Computer Siene University of Wrwik http://www.ds.wrwik..uk/~tiskin (inludes n extended version of this
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationWidth and Bounding Box of Imprecise Points
Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationCOSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview
COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationEnterprise Digital Signage Create a New Sign
Enterprise Digitl Signge Crete New Sign Intended Audiene: Content dministrtors of Enterprise Digitl Signge inluding stff with remote ess to sign.pitt.edu nd the Content Mnger softwre pplition for their
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationV = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)
Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from
More informationInter-domain Routing
COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationbox Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:
Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References
More informationIntroduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example
Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationAsurveyofpractical algorithms for suffix tree construction in external memory
Asurveyofprtil lgorithms for suffix tree onstrution in externl memory M. Brsky,, U. Stege n A. Thomo University of Vitori, PO Box, STN CSC Vitori, BC, VW P, Cn SUMMAY The onstrution of suffix trees in
More informationMcAfee Web Gateway
Relese Notes Revision C MAfee We Gtewy 7.6.2.11 Contents Aout this relese Enhnement Resolved issues Instlltion instrutions Known issues Additionl informtion Find produt doumenttion Aout this relese This
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationSMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS
Progress In Eletromgnetis Reserh C, Vol. 3, 195 22, 28 SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS W.-L. Chen nd G.-M. Wng Rdr Engineering Deprtment Missile Institute of Air Fore Engineering
More informationNetwork Layer: Routing Classifications; Shortest Path Routing
igitl ommuniction in the Modern World : Routing lssifictions; Shortest Pth Routing s min prolem: To get efficiently from one point to the other in dynmic environment http://.cs.huji.c.il/~com com@cs.huji.c.il
More informationc s ha2 c s Half Adder Figure 2: Full Adder Block Diagram
Adder Tk: Implement 2-it dder uing 1-it full dder nd 1-it hlf dder omponent (Figure 1) tht re onneted together in top-level module. Derie oth omponent in VHDL. Prepre two implementtion where VHDL omponent
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More informationIntroduction. Example
OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining
More information