WORKSHOP 9 HEX MESH USING SWEEP VECTOR

Size: px
Start display at page:

Download "WORKSHOP 9 HEX MESH USING SWEEP VECTOR"

Transcription

1 WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1

2 WS9-2

3 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re rete The trimme surfes re Pver meshe. For the meshing, lists(e.g. `list`) re use for the list of surfes. An IsoMesh is rete using two prllel opposing urves. Prior to meshing selet surfe eges n urves re mesh seee to fore the esire mesh size in selet regions. Finlly, the 2D qurlterl elements re swept to rete 3D hexherl elements. Some 2D elements re extrue using onstnt sweep vetor, e.g. <x y z>. Other elements re swept using previously rete vetor fiel. WS9-3

4 Suggeste Exerise Steps 1. Crete new tse. 2. Import the IGES file with urves. 3. Crete urve to interset two urves. 4. Brek two vertil urves for sie of moel. 5. Brek the reking urve. 6. Chnge the geometri shrink. 7. Crete group for qurter of the moel. 8. Brek fillet urve. 9. Disply trimme surfe lel for susequent trimme surfe retion. 10. Crete urves for trimme surfe retion. 11. Crete trimme surfes. 12. Crete mesh sees on selet surfe eges. 13. Crete the meshes for the surfes. 14. Crete lists for sweeping to rete soli elements. 15. Crete soli element meshes y sweeping. 16. Crete sptil vetor fiel. 17. Crete the reminer of the soli elements y sweeping using vetor fiel. 18. Disply of ll the soli elements. 19. Look for element free eges 20. Quit MSC.PATRAN. WS9-4

5 Step 1. Crete New Dtse Crete new tse lle on_ro... File/New.. Enter on_ro. for File nme.. Clik on OK.. Uner the New Moel Preferenes selet Bse on Moel for the Tolerne. e. Enter 200 for Approximte Mximum Moel Dimension. f. Selet MSC.Nstrn for Anlysis Coe. g. Selet Struturl for Anlysis Type. h. Clik on OK. e g h f WS9-5

6 Step 2. Import the IGES File With Curves Import the IGES file.. File/Import. Set the Ojet n Soure to Moel n IGES, respetively.. Fin n selet on_ro_new.igs for File nme.. Clik on Apply. e. Clik OK when the import summry ppers. WS9-6

7 Step 3. Crete Curve to Interset Two Curves Crete soli hex mesh for the lower right qurter of the moel. To o this the geometry moel must e eite. First, rete urve to interset setion of the moel.. Geometry: Crete/Curve/ XYZ.. Enter <60 0 0> for Vetor Coorintes List.. Enter [ ] for Origin Coorintes List.. Clik on Apply. Use this urve to rek the two urves tht it intersets. WS9-7

8 Step 4. Brek two Vertil Curves for Sie Brek two vertil urves(curve 27, 28) using the urve just rete(curve 43).. Zoom into moel s inite.. Geometry: Eit/Curve/Brek.. Selet Point for Option.. Selet Delete Originl Curves n Auto Exeute. e. Selet Curve 27 for Curve List. f. Uner Brek Point List selet the Curve interset ion, then Curve ion in the Selet Menu Br. e g. Selet Curve 27, then the interseting urve, Curve 43. h. Reply Yes when ske to elete originl urves. i. Repet the steps for urve 28, using urve 28 for Curve List, n the sme interseting urve. h WS9-8

9 Step 5. Brek the Breking Curve Now rek horizontl urve, Curve 43, t the point rete t n intersetion.. Selet Delete Originl Curves n Auto Exeute.. Selet Curve 43 for Curve List.. Selet the point t intersetion etween Curve 43 n Curve 45 for Brek Point List.. Clik Yes when sk to elete the originl urves. Point t Intersetion Curve 43 WS9-9

10 Step 5. Brek the Breking Curve (Cont.) Delete the urve to the right of the rek point.. Set Ation n Ojet to Delete n Curve, respetively.. Selet Curve 49 for Curve List.. Clik on Apply. Brek point Delete WS9-10

11 Step 6. Chnge the Geometri Shrink Use the geometri shrink to mke piking the entities esier.. Disply: Geometry. Using the slier set the Geometri Shrink to Clik on Apply, then Cnel.. Go to Front view. WS9-11

12 Step 7. Crete Group for Qurter of the Moel Crete group lle qurter_moel tht is to ontin the geometry in the lower right qurter of the moel.. Group: Crete/Selet Entity.. Enter qurter_moel for New Group Nme.. Selet Mke Current n Unpost All Other Groups.. Selet entities in the lower right orner s inite. Mke sure to inlue the points. Set the piking preferene to Enlose entire entity. e. Clik Apply, then Cnel. f. Disply/Geometry g. Chnge the geometri shrink k to 0.0. h. Clik Apply, then Cnel. e WS9-12

13 Step 8. Brek Fillet Curve Brek Curve 33 using the prmetri option.. Turn on the urve lels, n inrese point size.. Geometry: Eit/Curve/Brek.. Set Option to Prmetri.. Enter 0.5 for Brek Point. e. Selet Delete Originl Curves n Auto Exeute. f. Selet Curve 33 for Curve List. e Curve 33 g. Clik Yes when ske to elete the originl urve. h. Turn on the point lels, n turn off urve lels. f g WS9-13

14 Step 9. Disply Trimme Surfe Lel for Cretion Throughout the following steps severl urves will e rete, n they will e use in the retion of trimme surfes.. Disply/Entity Color/Lel/Rener. Selet Lel for Tsurf.. Clik on Apply then Cnel. Note tht there re no surfes. One they hve een rete the lels will pper. WS9-14

15 Step 10. Crete Curves for Trimme Surfes Now, rete 5 urves in orer to rete surfes.. Geometry: Crete/Curve/ Point.. Selet 2 Point for Option.. Selet Auto Exeute.. Uner Strting Point List selet Point 47. e. Uner Ening Point List selet Point 46. f. Below is tle listing the strting n ening points for ll five urves: e Curve First Curve Seon Curve Thir Curve Fourth Curve Strting Point Point 47 Point 44 Point 17 Point 48 Ening Point Point 46 Point 17 Point 3 Point 2 Fifth Curve Point 6 Point 4 WS9-15

16 Step 11. Crete Trimme Surfes Turn off the point lels, turn on the urve lels, turn on the surfe lels, n rete trimme surfes. g h. Turn off point lels, turn on urve lels, n turn on surfe lels.. Geometry: Crete/Surfe/ Trimme.. Selet Plnr for Option.. Clik on Auto Chin e f Chine urve e. Selet Current Group Only n Highlight Chin Cretion. i i f. Deselet Delete Constituent Curves. g. Selet Auto Exeute. h. Selet Curve 26 for Selet Strt Curve. i. Clik on the OK n Next uttons s neee. j. Cnel. The gol is to rete hine urve (see ove), then trimme surfe. Use the Next utton to selet ifferent pth, n the OK utton to ept the urrent pth. WS9-16

17 Step 11. Crete Trimme Surfes (Cont.) Crete the first trimme surfe.. Geometry: Crete/Surfe/ Trimme.. Selet Plnr for Option.. Outer Loop List: selet the hine urve just rete, e.g. Curve 56.. Apply. WS9-17

18 Step 11. Crete Trimme Surfes (Cont.) Continue reting the trimme surfes.. Repet the steps to rete the two remining trimme surfes. WS9-18

19 Step 12. Crete Mesh Sees on Surfe Eges Crete mesh sees spe uniformly long severl eges.. Turn on the urve lels.. Elements: Crete/Mesh See/ Uniform.. Selet Numer of Elements.. Enter 3 for Numer. e. Selet the two urves/eges uner Curve List. f. Clik on Apply. g. Repet the previous steps to rete mesh see with 5 elements on the inite urves/eges. e g 5 elements eh ege 3 elements eh ege e f WS9-19

20 Step 12. Crete Mesh Sees on Surfe Eges (Cont.) Chnge the view to see the other urves/eges.. Viewing: Angles. Selet Moel Asolute for Metho.. Enter for Angles.. Clik Apply, then Cnel. e. Zoom in on the inite re. WS9-20

21 Step 12. Crete Mesh Sees on Surfe Eges (Cont.) Crete mesh sees on itionl eges using one wy is. Elements: Crete/Mesh See/ One Wy Bis.. Selet Num Elems n L2/L1.. Enter 3 uner Numer.. Enter 2 uner L2/L1. e. Selet Auto Exeute. f. Selet Curve for Curve List. g. Chnge the L2/L1 to 0.5. h. Selet Curve 9 12 for Curve List. i. Chnge to Front view n turn off ll lels. j. Use Fit view. f WS9-21

22 Step 12. Crete Mesh Sees on Surfe Eges (Cont.) WS9-22

23 Step 13. Crete Meshes for the Surfes Crete meshes for the surfes.. Elements: Crete/Mesh/ Surfe.. Set Mesher to Pver.. Enter Surfe 1:3 for Surfe List.. Deselet Automti Clution n enter 5.0 for Glol Ege Length. e. Clik on Apply. e WS9-23

24 Step 13. Crete Meshes For the Surfes (Cont.) Mesh the remining surfe re using the 2 Curves option.. Zoom in on inite re, n turn on the urve lels.. Set Type to 2 Curves.. Enter Curve for Curve 1 List.. Enter Curve for Curve 2 List. e. Enter 5.0 for Glol Ege Length. f. Clik on Apply. g. Clik on Fit view n turn off the urve lels. e f WS9-24

25 Step 13. Crete Meshes For the Surfes (Cont.) WS9-25

26 Step 14. Crete Lists for Sweeping to Crete Soli Elements Crete two lists. The first ontining the elements ssoite with the onneting ro inner we, n the other ontining the remining elements ssoite with the other surfes.. Tools/List/Crete. Set the Moel, Ojet, n Metho to FEM, Element, n Assoition, respetively.. Selet Surfe uner Assoition.. Selet Surfe 3 uner Surfe. e. Selet A for the Trget List. g f. Clik on Apply. g. Selet Surfes 1 & 2 for Surfe. h. Chnge the Trget List to B. i. Clik on Apply, then Cnel. e f h i WS9-26

27 Step 15. Crete Soli Element Meshes y Sweeping Crete soli element meshes y sweeping the surfe meshes.. Elements: Sweep/ Element/Extrue.. Clik on Mesh Control... Enter 2 uner Numer.. Clik on OK. e. Enter <0 0 10> for Diretion Vetor. f. Selet Delete Originl Elements. g. Enter `list` for Bse Entity List. h. Clik on Apply. e g The extrue elements n e esily viewe using the Iso 1 view. h WS9-27

28 Step 15. Crete Soli Element Meshes y Sweeping (Cont.) f Extrue the remining surfe elements.. Elements: Sweep/Element/ Extrue.. Uner Mesh Control enter 4 uner Numer, n lik OK.. Enter <0 0 20> for Diretion Vetor.. Selet Delete Originl Elements. e. Enter `list` for Bse Entity List. f. Clik on Apply. g. Clik on the Smooth she ion. e f WS9-28

29 Step 16. Crete Sptil Vetor Fiel Crete sptil vetor fiel for extruing the remining surfe elements.. Fiels: Crete/Sptil/PCL Funtion.. Enter iretion_vetor for Fiel Nme.. Selet Vetor for Fiel Type.. Enter 0. for First Component. e. Enter 0. for Seon Component. f. Enter Z for Thir Component. g. Clik on Apply. h. Set the isply k to wire frme, n selet Front view. e f g WS9-29

30 Step 17. Crete the Reminer of the Soli Elements Crete the remining soli elements y sweeping the remining surfe elements using the vetor fiel.. Elements: Sweep/Element/Vetor Fiel.. Uner Mesh Control set Numer to 4, n lik OK.. Enter iretion_vetor for Fiel Nme.. Selet Delete Originl Elements. e. Selet the remining 2D elements, tht hve not een swept, for Bse Entity List. f. Clik on Apply. g. Go to Iso 1 view. e e f WS9-30

31 Step 18. All the Soli Elements WS9-31

32 Step 19. Look for Element Free Eges Chek the element free eges of the moel, equivlene, then hek the free eges gin.. Elements: Verify/Element/ Bounries.. Clik Apply.. Elements: Equivlene/All/ Tolerne Cue.. Clik Apply. e. Verify the free eges gin y repeting Steps n. WS9-32

33 Step 19. Look for Element Free Eges (Cont.) Chnge the isply to hien line while still in the verify moe.. Clik on the Hien line ion. WS9-33

34 Step 20. Quit MSC.Ptrn Quite MSC.PATRAN.. File : Close. This ens this exerise. WS9-34

WORKSHOP 8B TENSION COUPON

WORKSHOP 8B TENSION COUPON WORKSHOP 8B TENSION COUPON WS8B-2 Workshop Ojetives Prtie reting n eiting geometry Prtie mesh seeing n iso meshing tehniques. WS8B-3 Suggeste Exerise Steps 1. Crete new tse. 2. Crete geometry moel of the

More information

WORKSHOP 6 FRAME SURFACE MODEL ANALYSIS

WORKSHOP 6 FRAME SURFACE MODEL ANALYSIS WORKSHOP 6 FRAME SURFACE MODEL ANALYSIS WS6-1 WS6-2 Workshop Ojetives Crete finite element moel (meshes; onnet jent elements; pply e los, operting los, n grvity los; onstrin noes) for intermeitely iffiult

More information

WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS

WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS WS19-1 WS19-2 Prolem Desription This exerise is use to emonstrte how to mp isplement results from the nlysis of glol(overll) moel onto the perimeter of

More information

WORKSHOP 3 FRAME MODEL CREATION USING CURVES, AND ANALYSIS

WORKSHOP 3 FRAME MODEL CREATION USING CURVES, AND ANALYSIS WORKSHOP 3 FRAME MODEL CREATION USING CURVES, AND ANALYSIS WS3-1 WS3-2 Workshop Ojetives Moel simple frme struture using geometri urves n 1D Br elements. The frme moel is to e onstrine using pin restrints,

More information

WORKSHOP 8A TENSION COUPON

WORKSHOP 8A TENSION COUPON WORKSHOP 8A TENSION COUPON WS8A-2 Workshop Ojetives Buil the tension oupon geometry Control the mesh y using tehniques isusse in lss Compre FEA stress results to theoretil results From Stress Conentrtion

More information

WORKSHOP 2 CANTILEVERED PLATE

WORKSHOP 2 CANTILEVERED PLATE WORKSHOP 2 CANTILEVERED PLATE WS2-1 WS2-2 Prolem Desription This is simple exerise tht involves the simultion of the eformtion of ntilevere plte ue to the pplition of n en lo. The exerise involves 1) retion

More information

WORKSHOP 20 CREATING PCL FUNCTIONS

WORKSHOP 20 CREATING PCL FUNCTIONS WORKSHOP 20 CREATING PCL FUNCTIONS WS20-1 WS20-2 Problem Desription This exerise involves reating two PCL funtions that an be used to easily hange the view of a model. The PCL funtions are reated by reording

More information

WORKSHOP 10 HEX VS TET SOLID ELEMENT MESH

WORKSHOP 10 HEX VS TET SOLID ELEMENT MESH WORKSHOP 10 HEX VS TET SOLID ELEMENT MESH VS WS10-1 WS10-2 Problem Description This workshop is for creating a tetrahedral and hexahedral element mesh for a geometric solid. The tetrahedral mesh can be

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

Agilent G3314AA BioConfirm Software

Agilent G3314AA BioConfirm Software Agilent G3314AA BioConfirm Softwre Quik Strt Guide Use this guide to instll nd get strted with the BioConfirm softwre. Wht is BioConfirm Softwre? Agilent G3314AA BioConfirm Softwre lets you onfirm the

More information

A decision support system prototype for fuzzy multiple objective optimization

A decision support system prototype for fuzzy multiple objective optimization EUSFLAT - LFA A eision support system prototype for fuzzy multiple ojetive optimiztion Fengjie Wu Jie Lu n Gungqun Zhng Fulty of Informtion Tehnology University of Tehnology Syney Austrli E-mil: {fengjiewjieluzhngg}@it.uts.eu.u

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

Package Contents. Wireless-G USB Network Adapter with SpeedBooster USB Cable Setup CD-ROM with User Guide (English only) Quick Installation

Package Contents. Wireless-G USB Network Adapter with SpeedBooster USB Cable Setup CD-ROM with User Guide (English only) Quick Installation A Division of Ciso Systems, In. Pkge Contents Wireless-G USB Network Adpter with SpeedBooster USB Cle Setup CD-ROM with User Guide (English only) Quik Instlltion 2,4 GHz 802.11g Wireless Model No. Model

More information

Rolling Back Remote Provisioning Changes. Dell Command Integration for System Center

Rolling Back Remote Provisioning Changes. Dell Command Integration for System Center Rolling Bk Remote Provisioning Chnges Dell Commn Integrtion for System Center Notes, utions, n wrnings NOTE: A NOTE inites importnt informtion tht helps you mke etter use of your prout. CAUTION: A CAUTION

More information

McAfee Web Gateway

McAfee Web Gateway Relese Notes Revision C MAfee We Gtewy 7.6.2.11 Contents Aout this relese Enhnement Resolved issues Instlltion instrutions Known issues Additionl informtion Find produt doumenttion Aout this relese This

More information

Solids. Solids. Curriculum Ready.

Solids. Solids. Curriculum Ready. Curriulum Rey www.mthletis.om This ooklet is ll out ientifying, rwing n mesuring solis n prisms. SOM CUES The Som Cue ws invente y Dnish sientist who went y the nme of Piet Hein. It is simple 3 # 3 #

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

SAS Event Stream Processing 5.1: Using SAS Event Stream Processing Studio

SAS Event Stream Processing 5.1: Using SAS Event Stream Processing Studio SAS Event Strem Proessing 5.1: Using SAS Event Strem Proessing Stuio Overview to SAS Event Strem Proessing Stuio Overview SAS Event Strem Proessing Stuio is we-se lient tht enles you to rete, eit, uplo,

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

Agilent MassHunter Workstation Data Acquisition for 6400 Series Triple Quadrupole LC/MS Familiarization Guide

Agilent MassHunter Workstation Data Acquisition for 6400 Series Triple Quadrupole LC/MS Familiarization Guide Agilent MssHunter Worksttion Dt Aquisition for 6400 Series Triple Qudrupole LC/MS Fmiliriztion Guide Before you egin 3 Prepre your system 3 Prepre to quire dt 4 Exerise 1 Develop n quisition method 6 Tsk

More information

Finite Element Model

Finite Element Model LESSON 9 Finite Element Model Objectives: Build an initial surface mesh that will be used as a pattern to create the final 1, 2 and 3D mesh. Edit and smooth the mesh. Build a finite element model by sweeping

More information

WORKSHOP 4 MESH ON MESH 2D

WORKSHOP 4 MESH ON MESH 2D WORKSHOP 4 MESH ON MESH 2D WS4-1 WS4-2 Problem Description This exercise introduces another method of creating a 2D mesh for a set of non-congruent surfaces. So far non-congruent surfaces have been dealt

More information

High-performance Monitoring Software. User s Manual

High-performance Monitoring Software. User s Manual High-performne Monitoring Softwre User s Mnul Introdution Thnk you for purhsing WeView Livesope MV Ver. 2.1. Plese red this mnul prior to use to ensure tht you will e le to use this softwre effetively.

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Kulleġġ San Ġorġ Preca Il-Liċeo tas-subien Ħamrun. Name & Surname: A) Mark the correct answer by inserting an X in the correct box. a b c d.

Kulleġġ San Ġorġ Preca Il-Liċeo tas-subien Ħamrun. Name & Surname: A) Mark the correct answer by inserting an X in the correct box. a b c d. Kulleġġ Sn Ġorġ Pre Il-Liċeo ts-suien Ħmrun Hlf Yerly Exmintion 2012 Trk 3 Form 3 INFORMATION TECHNOLOGY Time : 1hr 30 mins Nme & Surnme: Clss: A) Mrk the orret nswer y inserting n X in the orret ox. 1)

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,

More information

McAfee Data Loss Prevention Prevent

McAfee Data Loss Prevention Prevent Quik Strt Guide Revision B MAfee Dt Loss Prevention Prevent version 10.x This quik strt guide provides high-level instrutions for setting up MAfee Dt Loss Prevention Prevent (MAfee DLP Prevent) hrdwre

More information

PROBLEM OF APOLLONIUS

PROBLEM OF APOLLONIUS PROBLEM OF APOLLONIUS In the Jnury 010 issue of Amerin Sientist D. Mkenzie isusses the Apollonin Gsket whih involves fining the rius of the lrgest irle whih just fits into the spe etween three tngent irles

More information

Troubleshooting. Verify the Cisco Prime Collaboration Provisioning Installation (for Advanced or Standard Mode), page

Troubleshooting. Verify the Cisco Prime Collaboration Provisioning Installation (for Advanced or Standard Mode), page Trouleshooting This setion explins the following: Verify the Ciso Prime Collortion Provisioning Instlltion (for Advned or Stndrd Mode), pge 1 Upgrde the Ciso Prime Collortion Provisioning from Smll to

More information

Enterprise Digital Signage Create a New Sign

Enterprise Digital Signage Create a New Sign Enterprise Digitl Signge Crete New Sign Intended Audiene: Content dministrtors of Enterprise Digitl Signge inluding stff with remote ess to sign.pitt.edu nd the Content Mnger softwre pplition for their

More information

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

INSTALLING PRIVA GATEWAY FOR PRIVA CONNEXT

INSTALLING PRIVA GATEWAY FOR PRIVA CONNEXT INSTALLING PRIVA GATEWAY FOR PRIVA CONNEXT 1 Collet informtion 2 Power up Gtewy 3 Connet lptop with Gtewy 4 Gtewy setup: Updte, login nd onfigure 5 Connet with Priv Proess omputers in network 6 Strt Priv

More information

WORKSHOP 12 ANCHOR LOADS AND BOUNDARY CONDITIONS USING A FIELD

WORKSHOP 12 ANCHOR LOADS AND BOUNDARY CONDITIONS USING A FIELD WORKSHOP 12 ANCHOR LOADS AND BOUNDARY CONDITIONS USING A FIELD WS12-1 WS12-2 Workshop Ojtivs Using fil for prssur loing, n rting onstrints t th lotions for wshrs Prolm Dsription Crt fil with th sin funtion,

More information

Width and Bounding Box of Imprecise Points

Width and Bounding Box of Imprecise Points Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Introducing fractions

Introducing fractions Introduing frtions Nme Colour hlf of eh shpe: Show the following fr ons: out of out of out of Lel these fr ons: Shde these fr ons: 7 0 Represents ommon fr ons on different models Interprets the numertor

More information

5 ANGLES AND POLYGONS

5 ANGLES AND POLYGONS 5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.

More information

McAfee Network Security Platform

McAfee Network Security Platform NS3x00 Quik Strt Guide Revision B MAfee Network Seurity Pltform This quik strt guide explins how to quikly set up nd tivte your MAfee Network Seurity Pltform NS3100 nd NS3200 Sensors in inline mode. These

More information

Agilent Mass Hunter Software

Agilent Mass Hunter Software Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss

More information

c s ha2 c s Half Adder Figure 2: Full Adder Block Diagram

c s ha2 c s Half Adder Figure 2: Full Adder Block Diagram Adder Tk: Implement 2-it dder uing 1-it full dder nd 1-it hlf dder omponent (Figure 1) tht re onneted together in top-level module. Derie oth omponent in VHDL. Prepre two implementtion where VHDL omponent

More information

Containers: Queue and List

Containers: Queue and List Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of

More information

GENG2140 Modelling and Computer Analysis for Engineers

GENG2140 Modelling and Computer Analysis for Engineers GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points

More information

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

All in One Kit. Quick Start Guide CONNECTING WITH OTHER DEVICES SDE-4003/ * 27. English-1

All in One Kit. Quick Start Guide CONNECTING WITH OTHER DEVICES SDE-4003/ * 27. English-1 All in One Kit Quik Strt Guide SDE-00/00 CONNECTING WITH OTHER DEVICES Lol PC Brodnd Modem Brodnd Router or HUB CH CH CH CH 9 0 G 9 0 ALARM RS- OUT G DC V If you do not use the Internet, just follow the

More information

Error Numbers of the Standard Function Block

Error Numbers of the Standard Function Block A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution

More information

Line The set of points extending in two directions without end uniquely determined by two points. The set of points on a line between two points

Line The set of points extending in two directions without end uniquely determined by two points. The set of points on a line between two points Lines Line Line segment Perpendiulr Lines Prllel Lines Opposite Angles The set of points extending in two diretions without end uniquely determined by two points. The set of points on line between two

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Table-driven look-ahead lexical analysis

Table-driven look-ahead lexical analysis Tle-riven look-he lexil nlysis WUU YANG Computer n Informtion Siene Deprtment Ntionl Chio-Tung University, HsinChu, Tiwn, R.O.C. Astrt. Moern progrmming lnguges use regulr expressions to efine vli tokens.

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Type Checking. Roadmap (Where are we?) Last lecture Context-sensitive analysis. This lecture Type checking. Symbol tables

Type Checking. Roadmap (Where are we?) Last lecture Context-sensitive analysis. This lecture Type checking. Symbol tables Type Cheking Rodmp (Where re we?) Lst leture Contet-sensitie nlysis Motition Attriute grmmrs Ad ho Synt-direted trnsltion This leture Type heking Type systems Using synt direted trnsltion Symol tles Leil

More information

INTEGRATED WORKFLOW ART DIRECTOR

INTEGRATED WORKFLOW ART DIRECTOR ART DIRECTOR Progrm Resoures INTEGRATED WORKFLOW PROGRAM PLANNING PHASE In this workflow phse proess, you ollorte with the Progrm Mnger, the Projet Mnger, nd the Art Speilist/ Imge Led to updte the resoures

More information

Lab 1 - Counter. Create a project. Add files to the project. Compile design files. Run simulation. Debug results

Lab 1 - Counter. Create a project. Add files to the project. Compile design files. Run simulation. Debug results 1 L 1 - Counter A project is collection mechnism for n HDL design under specifiction or test. Projects in ModelSim ese interction nd re useful for orgnizing files nd specifying simultion settings. The

More information

COMPUTER EDUCATION TECHNIQUES, INC. (XML ) SA:

COMPUTER EDUCATION TECHNIQUES, INC. (XML ) SA: In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following

More information

Imported Geometry Cleaning

Imported Geometry Cleaning LESSON 8 Imported Geometry Cleaning Objectives: Import CAD geometry. Identify problems with imported geometry. Fix geometry for the purpose of meshing. PATRAN 302 Exercise Workbook - Release 8.0 8-1 8-2

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Parallelization Optimization of System-Level Specification

Parallelization Optimization of System-Level Specification Prlleliztion Optimiztion of System-Level Speifition Luki i niel. Gjski enter for Emedded omputer Systems University of liforni Irvine, 92697, US {li, gjski} @es.ui.edu strt This pper introdues the prlleliztion

More information

COMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA:

COMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA: In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following

More information

License Manager Installation and Setup

License Manager Installation and Setup The Network License (concurrent-user) version of e-dpp hs hrdwre key plugged to the computer running the License Mnger softwre. In the e-dpp terminology, this computer is clled the License Mnger Server.

More information

Internet Routing. Reminder: Routing. CPSC Network Programming

Internet Routing. Reminder: Routing. CPSC Network Programming PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet

More information

Importing Geometry from an IGES file

Importing Geometry from an IGES file WORKSHOP 2 Importing Geometry from an IGES file Objectives: Import geometry from an IGES file. Create a solid from curves and surfaces. Tet mesh the solid. MSC.Patran 301 Exercise Workbook 2-1 2-2 MSC.Patran

More information

Cameras. Importance of camera models

Cameras. Importance of camera models pture imges mesuring devie Digitl mers mers fill in memor ith olor-smple informtion D hrge-oupled Devie insted of film film lso hs finite resolution grininess depends on speed IS 00 00 6400 sie 35mm IMAX

More information

ORGANIZER QUICK START GUIDE

ORGANIZER QUICK START GUIDE NOTES ON USING GOTOWEBINAR GoToWeinr Orgnizers my hol Weinrs for up to 1,000 ttenees. The Weinr proess n e roken into three stges: Weinr Plnning, Weinr Presenttion n Weinr Follow-up. Orgnizers nee to first

More information

the machine and check the components AC Power Cord Carrier Sheet/ Plastic Card Carrier Sheet DVD-ROM

the machine and check the components AC Power Cord Carrier Sheet/ Plastic Card Carrier Sheet DVD-ROM Quik Setup Guide Strt Here ADS-2100 Plese red the Produt Sfety Guide first efore you set up your mhine. Then, plese red this Quik Setup Guide for the orret setup nd instlltion. WARNING WARNING indites

More information

Math 227 Problem Set V Solutions. f ds =

Math 227 Problem Set V Solutions. f ds = Mth 7 Problem Set V Solutions If is urve with prmetriztion r(t), t b, then we define the line integrl f ds b f ( r(t) ) dr dt (t) dt. Evlute the line integrl f(x,y,z)ds for () f(x,y,z) xosz, the urve with

More information

Cooperative Routing in Multi-Source Multi-Destination Multi-hop Wireless Networks

Cooperative Routing in Multi-Source Multi-Destination Multi-hop Wireless Networks oopertive Routing in Multi-Soure Multi-estintion Multi-hop Wireless Networks Jin Zhng Qin Zhng eprtment of omputer Siene n ngineering Hong Kong University of Siene n Tehnology, HongKong {zjzj, qinzh}@se.ust.hk

More information

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator. COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

Composite Trimmed Surfaces

Composite Trimmed Surfaces LESSON 4 Composite Trimmed Surfaces Y Objectives: Import a CAD model into a database. Repair disjointed surfaces by creating composite surfaces. Mesh the newly created composite surfaces PATRAN 302 Exercise

More information

Digital Design. Chapter 1: Introduction. Digital Design. Copyright 2006 Frank Vahid

Digital Design. Chapter 1: Introduction. Digital Design. Copyright 2006 Frank Vahid Chpter : Introduction Copyright 6 Why Study?. Look under the hood of computers Solid understnding --> confidence, insight, even better progrmmer when wre of hrdwre resource issues Electronic devices becoming

More information

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front

More information

Installation Guide for

Installation Guide for Zenoss Servie Impt Instlltion Guide for Resoure Mnger 4.2 Relese 5.0.0 Zenoss, In. www.zenoss.om Zenoss Servie Impt Instlltion Guide for Resoure Mnger 4.2 Copyright 2015 Zenoss, In. All rights reserved.

More information

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414 Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro

More information

F. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997.

F. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997. Forced convex n-gons in the plne F. R. K. Chung y University ofpennsylvni Phildelphi, Pennsylvni 19104 R. L. Grhm AT&T Ls - Reserch Murry Hill, New Jersey 07974 Mrch 2,1997 Astrct In seminl pper from 1935,

More information

Construct Hybrid Microcircuit Geometry

Construct Hybrid Microcircuit Geometry Exercise Construct Hybrid Microcircuit 8 8 9 9 6 6 7 7 0 2 3 4 5 2 3 4 5 Y Z X Objective: In this exercise you will construct a trimmed surface which will be the underlying geometry of a 3D Hybrid Microcircuit

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Mass Properties Calculations

Mass Properties Calculations LESSON 15 Mass Properties Calculations Objectives Import a unigraphics express file and apply mass properties to the propeller. PAT302 Exercise Workbook MSC/PATRAN Version 8.0 15-1 15-2 PAT302 Exercise

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

CS453 INTRODUCTION TO DATAFLOW ANALYSIS

CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register

More information

Building the Finite Element Model of a Space Satellite

Building the Finite Element Model of a Space Satellite Exercise 4 Building the Finite Element Model of a Space Satellite 30000 20000 Objectives: mesh & MPC s on a Space Satellite. Perform Model and Element Verification. Learn how to control mesh parameters

More information

Graph Contraction and Connectivity

Graph Contraction and Connectivity Chpter 14 Grph Contrtion n Connetivity So fr we hve mostly overe tehniques for solving problems on grphs tht were evelope in the ontext of sequentil lgorithms. Some of them re esy to prllelize while others

More information

LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION

LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION Overview LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION 4.4.1.0 Due to the omplex nture of this updte, plese fmilirize yourself with these instrutions nd then ontt RGB Spetrum Tehnil

More information

To access your mailbox from inside your organization. For assistance, call:

To access your mailbox from inside your organization. For assistance, call: 2001 Ative Voie, In. All rights reserved. First edition 2001. Proteted y one or more of the following United Sttes ptents:,070,2;,3,90;,88,0;,33,102;,8,0;,81,0;,2,7;,1,0;,90,88;,01,11. Additionl U.S. nd

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Please read the Product Safety Guide first before you set up your machine. Then, read this Quick Setup Guide for the correct setup and installation.

Please read the Product Safety Guide first before you set up your machine. Then, read this Quick Setup Guide for the correct setup and installation. Quik Setup Guie Strt Here MFC-J6920DW Plese re the Prout Sfety Guie first efore you set up your mhine. Then, re this Quik Setup Guie for the orret setup n instlltion. WARNING CAUTION IMPORTANT WARNING

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Linear Bifurcation Buckling Analysis of Thin Plate

Linear Bifurcation Buckling Analysis of Thin Plate LESSON 13a Linear Bifurcation Buckling Analysis of Thin Plate Objectives: Construct a quarter model of a simply supported plate. Place an edge load on the plate. Run an Advanced FEA bifurcation buckling

More information

Start Here. Remove all tape and lift display. Locate components

Start Here. Remove all tape and lift display. Locate components HP Photosmrt 2600/2700 series ll-in-one User Guide Strt Here 1 USB cle users: Do not connect the USB cle until this guide instructs you to or the softwre my not instll properly. Use this guide to set up

More information

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs Byesin Networks: Direte Mrkov Properties (Cont ) n Mrkov Equivlent DAGs Huizhen Yu jney.yu@s.helsinki.fi Dept. Computer Siene, Univ. of Helsinki Proilisti Moels, Spring, 2010 Huizhen Yu (U.H.) Byesin Networks:

More information

Start Here. Quick Setup Guide HL-5470DW(T) HL-6180DW(T) WARNING CAUTION WARNING. Note

Start Here. Quick Setup Guide HL-5470DW(T) HL-6180DW(T) WARNING CAUTION WARNING. Note Quik Setup Guie Strt Here HL-5470DW(T) HL-6180DW(T) Plese re the Prout Sfety Guie first, then re this Quik Setup Guie for the orret setup n instlltion proeure. To view the Quik Setup Guie in other lnguges,

More information

Photovoltaic Panel Modelling Using a Stochastic Approach in MATLAB &Simulink

Photovoltaic Panel Modelling Using a Stochastic Approach in MATLAB &Simulink hotovolti nel Modelling Using Stohsti Approh in MATLAB &Simulink KAREL ZALATILEK, JAN LEUCHTER eprtment of Eletril Engineering University of efene Kouniov 65, 61 City of Brno CZECH REUBLIC krelzpltilek@unoz,

More information