Comparison-based Choices

Size: px
Start display at page:

Download "Comparison-based Choices"

Transcription

1 Comprison-se Choies John Ugner Mngement Siene & Engineering Stnfor University Joint work with: Jon Kleinerg (Cornell) Senhil Mullinthn (Hrvr) EC 17 Boston June 28, 2017

2 Preiting isrete hoies Clssi prolem: onsumer preferenes [Thurstone 27, Lue 59], ommuting [MFen 78], shool hoie [Kohn-Mnski-Munel 76]

3 Preiting online isrete hoies

4 Preiting online isrete hoies How well n we lern/preit hoie set effets?.k.. violtions of the inepenene of irrelevnt lterntives (IIA) [Sheffet-Mishr-Ieong ICML 2012, Yin et l. WSDM 2014]

5 Choie set effets Bis towrs moertion, ompromise effet [Simonson 1989, Simonson-Tversky 1992, Kmeni 2008, Trueloo 2013]

6 Choie set effets Bis towrs moertion, ompromise effet megpixels weight [Simonson 1989, Simonson-Tversky 1992, Kmeni 2008, Trueloo 2013]

7 Choie set effets Bis towrs moertion, ompromise effet megpixels weight [Simonson 1989, Simonson-Tversky 1992, Kmeni 2008, Trueloo 2013]

8 Choie set effets Bis towrs moertion, ompromise effet megpixels Similrity version weight [Simonson 1989, Simonson-Tversky 1992, Kmeni 2008, Trueloo 2013] megpixels weight

9 Choie set effets Bis towrs moertion, ompromise effet megpixels Similrity version weight [Simonson 1989, Simonson-Tversky 1992, Kmeni 2008, Trueloo 2013] megpixels weight

10 Choie set effets Bis towrs moertion, ompromise effet megpixels Orinl omprisons Similrity version [Simonson 1989, Simonson-Tversky 1992, Kmeni 2008, Trueloo 2013] megpixels weight weight Similrity requires istne

11 The present work Fouse on omprison-se funtions. Investigte symptoti query omplexity: if n gent mkes omprison-se hoies, how hr to lern their hoie funtion? Assume popultion is not lerning, mening hoie set effets re not trnsient irrtionlity. Severl query frmeworks: Ative queries vs. pssive strem of queries Fixe hoie funtion vs. mixture of hoie funtions

12 The present work Fouse on omprison-se funtions. Investigte symptoti query omplexity: if n gent mkes omprison-se hoies, how hr to lern their hoie funtion? Assume popultion is not lerning, mening hoie set effets re not trnsient irrtionlity. Severl query frmeworks: Ative queries vs. pssive strem of queries Fixe hoie funtion vs. mixture of hoie funtions Bsi tkewy: omprison-se funtions in one imension (still rih!) re no hrer to lern thn inry omprisons (sorting).

13 Comprison-se hoie funtions Definition: Given set of lterntives U, hoie funtion f mps every non-empty S U to n element u S. Exmple: S U: f( ) = u

14 Comprison-se hoie funtions Definition: Given set of lterntives U, hoie funtion f mps every non-empty S U to n element u S. Exmple: S U: f( ) = u Emeing items: Consier U s emee in ttriute spe, h:u->x For X = R 1, h(ui) re utilities: e

15 Comprison-se hoie funtions Definition: Given set of lterntives U, hoie funtion f mps every non-empty S U to n element u S. Exmple: S U: f( ) = u Emeing items: Consier U s emee in ttriute spe, h:u->x For X = R 1, h(ui) re utilities: Comprison-se funtions: Definition: Choie funtions tht n e written s omprisons (<,>,=) over {h(ui): ui S}. e

16 Comprison-se hoie funtions In one imension, omprison-se funtions re ll position-seletion funtions: selet l-of-k. Exmple: k=4, l=2 f(s) =

17 Comprison-se hoie funtions In one imension, omprison-se funtions re ll position-seletion funtions: selet l-of-k. Exmple: k=4, l=2 f(s) = Seleting 1-of-2 is sorting. Fous on k-sets S with fixe k.

18 Comprison-se hoie funtions In one imension, omprison-se funtions re ll position-seletion funtions: selet l-of-k. Exmple: k=4, l=2 f(s) = f(s) = e e Seleting 1-of-2 is sorting. Fous on k-sets S with fixe k. Position-seletion funtions exhiit hoie set effets.

19 Query omplexity Oserve sequene of (hoie set, hoie) pirs (S, f(s)). How mny o we nee to oserve to report f(s) for (lmost) ll S?

20 Query omplexity Oserve sequene of (hoie set, hoie) pirs (S, f(s)). How mny o we nee to oserve to report f(s) for (lmost) ll S? Ative vs. pssive queries Ative: n hoose wht k-set S to query next, sequentilly. Pssive: Strem of rnom k-sets S. Fixe vs. mixe hoie funtions Fixe: ll queries of sme `-of-k funtion. Mixe: mixture ( 1,..., k ) of ifferent positions selete.

21 Query omplexity, inry hoies How oes sorting (1-of-2) fit in this query omplexity frmework? Mixe inry hoie funtions mp to (p,1-p) noisy sorting. Ative Fixe Sorting from omprisons O(n log n) Mixe Sorting with noisy omprisons (Feige et l. 1994) O(n log n) Pssive Sorting in one roun (Alon-Azr 1988) O(n log n loglog n)?

22 Query omplexity, k-set hoies Sorting results trnslte to position-seletion funtions: Ative Fixe Two-phse lgorithm O(n log n) Mixe Apttion of two-phse lgorithm O(n log n) Pssive Streming moel O(n k-1 log n loglog n)?

23 Query omplexity: tive, fixe Phse 1: fin ineligile lterntives vi isr lgorithm f(s) = = ineligile lterntives S = S 2 = { } { } k ` item(s) ` 1 item(s)

24 Query omplexity: tive, fixe Phse 1: fin ineligile lterntives vi isr lgorithm f(s) = = ineligile lterntives S = S 2 = { } { } k ` item(s) ` 1 item(s) Phse 2: P hoie set with ineligile lterntives, o inry sort.

25 Query omplexity: tive, fixe Phse 1: fin ineligile lterntives vi isr lgorithm f(s) = = ineligile lterntives S = S 2 = { } { } k ` item(s) ` 1 item(s) Phse 2: P hoie set with ineligile lterntives, o inry sort. O(n) queries in isr lgorithm, O(n log n) queries to sort. Only reovers orer, not orienttion: on t know if pe sort is mx or min, ut not neee to reover f(s) for ever S. Algorithm oesn t epen on wht position is eing selete for.

26 Query omplexity: tive, mixe Inste of `-of-k, mixture of positions with proilities ( 1,..., k ), onstnt seprtion. f(s) = 0: Estimte proilities of eh position y stuying k+1-set losely. 1: Run isr phse O(log n) times, fin mx-ineligile lterntives 2: Cn then p hoie set n run noisy mx with (mx, min, fil) outomes inste of (mx, min) outomes s in (Feige et l. 1994).

27 Query omplexity: tive, mixe Inste of `-of-k, mixture of positions with proilities ( 1,..., k ), onstnt seprtion. f(s) = 0: Estimte proilities of eh position y stuying k+1-set losely. 1: Run isr phse O(log n) times, fin mx-ineligile lterntives 2: Cn then p hoie set n run noisy mx with (mx, min, fil) outomes inste of (mx, min) outomes s in (Feige et l. 1994). O(1) queries estimte proilities, O(n log n) queries in isr lgorithm, O(n log n) queries to sort. Nee to ook-keep mny filure proilities, ut stright forwr.

28 Query omplexity: pssive, fixe Pssive query moel: Poisson proess where eh k-set enters the strem with equl rte α. See given k-set in intervl [0,T] with proility pt. How long n intervl [0,T] o we nee to oserve strem? Phse 1: use queries in [0,T1], with T1 lrge enough so tht ll items exept ineligile lterntives re hosen. Phse 2: Simulte pirwise omprisons using queries where k-2 of the elements re ineligile.

29 Query omplexity: pssive, fixe Pssive query moel: Poisson proess where eh k-set enters the strem with equl rte α. See given k-set in intervl [0,T] with proility pt. How long n intervl [0,T] o we nee to oserve strem? Phse 1: use queries in [0,T1], with T1 lrge enough so tht ll items exept ineligile lterntives re hosen. Phse 2: Simulte pirwise omprisons using queries where k-2 of the elements re ineligile. For Phse 2 to work, nee pt to e O(log n loglog n / n). En up seeing ~log(n)/n frtion of ll (n hoose k) hoie sets. For k 3, proof only works for positions 1<l<k, not l=1 or l=k, whih reks our nlysis (pt 0).

30 Query omplexity, k-set hoies Sorting results trnslte to position-seletion funtions: Ative Fixe Two-phse lgorithm O(n log n) Mixe No new iffiulties O(n log n) Pssive Streming moel O(n k-1 log n loglog n)? Immeite questions: Better lgo for pssive strem; sorting in one noisy roun ; higher-im omprison funtions; istne-omprison.

31 Distne-omprison-se hoie Distne-omprison-se funtions re omprison funtions on the set of pirwise istnes.

32 Distne-omprison-se hoie Distne-omprison-se funtions re omprison funtions on the set of pirwise istnes. Distne-omprison vs. omprison funtions re quite ifferent. istne omprison omprison

33 Distne-omprison-se hoie Distne-omprison-se funtions re omprison funtions on the set of pirwise istnes. Distne-omprison vs. omprison funtions re quite ifferent. istne omprison 1D mein omprison Comprison funtions: Cn not express similrity (only orer) Distne-omprison funtions: Cn not mximize or minimize (istnes re ll internl to set)

34 Distne-omprison-se hoie Distne-omprison-se funtions re omprison funtions on the set of pirwise istnes. Pper poses mny questions out istne-omprison, few nswers. Relte to open lerning questions for: Crow mein lgorithm [Heikinheimo-Ukkonen 2013] Stohsti triplet emeing [Vn Der Mten-Weinerger 2012] Crowsoure lustering [Vinyk-Hssii 2016] Metri emeing [Shultz-Johims 2004].

35 Summry Inferene for omprison-se funtions generlly not more iffiult thn sorting. Ative vs. pssive, fixe vs. mixe query omplexity frmeworks. Open questions: Results for high-im (EBA?), istne-omprison, RUMs. Lerning/non-stti gents? Other reent work: [Benson et l. WWW 16] On the relevne of irrelevnt lterntives [Ugner-Rgin, NIPS 16] Mrkov hin moel generlizing BTL/MNL, n violte IIA. [Mystre-Grossgluser ICML 17] For BTL with ~uniform qulity, log 5 (n) inepenent Quiksorts reover ext rnk for lmost ll items. [Peyskhovih-Ugner NetEon 17] Mhine lerning pttion of the Simonson- Tversky moel for ontextul utility.

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model.

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model. Introutory Eonometris: A Moern Approh 6th Eition Woolrige Test Bnk Solutions Complete ownlo: https://testbnkre.om/ownlo/introutory-eonometris-moern-pproh-6th-eition-jeffreym-woolrige-test-bnk/ Solutions

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

XML and Databases. Outline. XPath. Outline - Lectures. XPath Data Model. Outline - Assignments. XPath. Sebastian Maneth NICTA and UNSW

XML and Databases. Outline. XPath. Outline - Lectures. XPath Data Model. Outline - Assignments. XPath. Sebastian Maneth NICTA and UNSW Outline XML n Dtses Leture 6 Noe Seleting Queries: XPth 1.0 1. XPth Dt Moel: 7 types of noes 2. Simple Exmples 3. Lotion Steps n Pths 4. Vlue Comprison, n Other Funtions Sestin Mneth NICTA n UNSW CSE@UNSW

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Duality in linear interval equations

Duality in linear interval equations Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny

More information

Lecture 12 : Topological Spaces

Lecture 12 : Topological Spaces Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X

More information

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Containers: Queue and List

Containers: Queue and List Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Graph Contraction and Connectivity

Graph Contraction and Connectivity Chpter 14 Grph Contrtion n Connetivity So fr we hve mostly overe tehniques for solving problems on grphs tht were evelope in the ontext of sequentil lgorithms. Some of them re esy to prllelize while others

More information

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs Byesin Networks: Direte Mrkov Properties (Cont ) n Mrkov Equivlent DAGs Huizhen Yu jney.yu@s.helsinki.fi Dept. Computer Siene, Univ. of Helsinki Proilisti Moels, Spring, 2010 Huizhen Yu (U.H.) Byesin Networks:

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

WORKSHOP 9 HEX MESH USING SWEEP VECTOR

WORKSHOP 9 HEX MESH USING SWEEP VECTOR WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1 WS9-2 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re

More information

Introduction to Algebra

Introduction to Algebra INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that Setion 2.3 Funtions Definition: Let n e sets. funtion (mpping, mp) f from to, enote f :, is suset of suh tht x[x y[y < x, y > f ]] n [< x, y 1 > f < x, y 2 > f ] y 1 = y 2 Note: f ssoites with eh x in

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS

WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS WS19-1 WS19-2 Prolem Desription This exerise is use to emonstrte how to mp isplement results from the nlysis of glol(overll) moel onto the perimeter of

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

A matching algorithm for measuring the structural similarity between an XML document and a DTD and its applications $

A matching algorithm for measuring the structural similarity between an XML document and a DTD and its applications $ Informtion Systems 29 (2004) 23 46 A mthing lgorithm for mesuring the struturl similrity etween n XML oument n DTD n its pplitions $ Elis Bertino, Giovnn Guerrini, Mro Mesiti, * Diprtimento i Informti

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

PROBLEM OF APOLLONIUS

PROBLEM OF APOLLONIUS PROBLEM OF APOLLONIUS In the Jnury 010 issue of Amerin Sientist D. Mkenzie isusses the Apollonin Gsket whih involves fining the rius of the lrgest irle whih just fits into the spe etween three tngent irles

More information

Three planes in networks

Three planes in networks Three plnes in networks Prof. Mlthi eerrghvn Ele. & Comp. Engg. Dept/CATT Polytehni University mv@poly.eu M. eerrghvn 1 Polytehni University User plne, ontrol plne, n mngement plne Mngement plne: onsists

More information

Kinetic Collision Detection: Algorithms and Experiments

Kinetic Collision Detection: Algorithms and Experiments Kineti Collision Detetion: Algorithms n Experiments Leonis J. Guis Feng Xie Li Zhng Computer Siene Deprtment, Stnfor University Astrt Effiient ollision etetion is importnt in mny rooti tsks, from high-level

More information

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Solids. Solids. Curriculum Ready.

Solids. Solids. Curriculum Ready. Curriulum Rey www.mthletis.om This ooklet is ll out ientifying, rwing n mesuring solis n prisms. SOM CUES The Som Cue ws invente y Dnish sientist who went y the nme of Piet Hein. It is simple 3 # 3 #

More information

Hash-based Subgraph Query Processing Method for Graph-structured XML Documents

Hash-based Subgraph Query Processing Method for Graph-structured XML Documents Hsh-bse Subgrph Query Proessing Metho for Grph-struture XML Douments Hongzhi Wng Hrbin Institute of Teh. wngzh@hit.eu.n Jinzhong Li Hrbin Institute of Teh. lijzh@hit.eu.n Jizhou Luo Hrbin Institute of

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414 Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Structure in solution spaces: Three lessons from Jean-Claude

Structure in solution spaces: Three lessons from Jean-Claude Struture in solution spes: Three lessons from Jen-Clue Dvi Eppstein Computer Siene Deprtment, Univ. of Cliforni, Irvine Conferene on Meningfulness n Lerning Spes: A Triute to the Work of Jen-Clue Flmgne

More information

GENG2140 Modelling and Computer Analysis for Engineers

GENG2140 Modelling and Computer Analysis for Engineers GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

5 ANGLES AND POLYGONS

5 ANGLES AND POLYGONS 5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.

More information

Internet Routing. Reminder: Routing. CPSC Network Programming

Internet Routing. Reminder: Routing. CPSC Network Programming PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,

More information

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors. 6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!

More information

Can Pythagoras Swim?

Can Pythagoras Swim? Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify

More information

A decision support system prototype for fuzzy multiple objective optimization

A decision support system prototype for fuzzy multiple objective optimization EUSFLAT - LFA A eision support system prototype for fuzzy multiple ojetive optimiztion Fengjie Wu Jie Lu n Gungqun Zhng Fulty of Informtion Tehnology University of Tehnology Syney Austrli E-mil: {fengjiewjieluzhngg}@it.uts.eu.u

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

Approximate computations

Approximate computations Living with floting-point numers Stndrd normlized representtion (sign + frction + exponent): Approximte computtions Rnges of vlues: Representtions for:, +, +0, 0, NN (not numer) Jordi Cortdell Deprtment

More information

Graph theory Route problems

Graph theory Route problems Bhelors thesis Grph theory Route prolems Author: Aolphe Nikwigize Dte: 986 - -5 Sujet: Mthemtis Level: First level (Bhelor) Course oe: MAE Astrt In this thesis we will review some route prolems whih re

More information

Parallelization Optimization of System-Level Specification

Parallelization Optimization of System-Level Specification Prlleliztion Optimiztion of System-Level Speifition Luki i niel. Gjski enter for Emedded omputer Systems University of liforni Irvine, 92697, US {li, gjski} @es.ui.edu strt This pper introdues the prlleliztion

More information

Scalable Spatio-temporal Continuous Query Processing for Location-aware Services

Scalable Spatio-temporal Continuous Query Processing for Location-aware Services Slle Sptio-temporl Continuous uery Proessing for Lotion-wre Servies iopeng iong Mohme F. Mokel Wli G. Aref Susnne E. Hmrush Sunil Prhkr Deprtment of Computer Sienes, Purue University, West Lfyette, IN

More information

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The

More information

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator. COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Asurveyofpractical algorithms for suffix tree construction in external memory

Asurveyofpractical algorithms for suffix tree construction in external memory Asurveyofprtil lgorithms for suffix tree onstrution in externl memory M. Brsky,, U. Stege n A. Thomo University of Vitori, PO Box, STN CSC Vitori, BC, VW P, Cn SUMMAY The onstrution of suffix trees in

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Pipeline Example: Cycle 1. Pipeline Example: Cycle 2. Pipeline Example: Cycle 4. Pipeline Example: Cycle 3. 3 instructions. 3 instructions.

Pipeline Example: Cycle 1. Pipeline Example: Cycle 2. Pipeline Example: Cycle 4. Pipeline Example: Cycle 3. 3 instructions. 3 instructions. ipeline Exmple: Cycle 1 ipeline Exmple: Cycle X X/ /W X X/ /W $3,$,$1 lw $,0($5) $3,$,$1 3 instructions 8 9 ipeline Exmple: Cycle 3 ipeline Exmple: Cycle X X/ /W X X/ /W sw $6,($7) lw $,0($5) $3,$,$1 sw

More information

Table-driven look-ahead lexical analysis

Table-driven look-ahead lexical analysis Tle-riven look-he lexil nlysis WUU YANG Computer n Informtion Siene Deprtment Ntionl Chio-Tung University, HsinChu, Tiwn, R.O.C. Astrt. Moern progrmming lnguges use regulr expressions to efine vli tokens.

More information

Declarative Routing: Extensible Routing with Declarative Queries

Declarative Routing: Extensible Routing with Declarative Queries elrtive Routing: Extensile Routing with elrtive Queries Boon Thu Loo 1 Joseph M. Hellerstein 1,2, Ion toi 1, Rghu Rmkrishnn3, 1 University of Cliforni t Berkeley, 2 Intel Reserh Berkeley, 3 University

More information

Midterm Exam CSC October 2001

Midterm Exam CSC October 2001 Midterm Exm CSC 173 23 Otoer 2001 Diretions This exm hs 8 questions, severl of whih hve suprts. Eh question indites its point vlue. The totl is 100 points. Questions 5() nd 6() re optionl; they re not

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Introduction to Electronic Design Automation. Testing. Design Flow. Testing

Introduction to Electronic Design Automation. Testing. Design Flow. Testing Introution to Eletroni esign Automtion Testing Jie-Hong Roln Jing 江介宏 eprtment of Eletril Engineering Ntionl Tiwn University Spring 23 Slies re y Courtesy of Prof. S.-Y. Hung n C.-M. Li 2 Testing esign

More information

EVALUATING AND ANALYSING DYNAMIC PLAYLIST GENERATION HEURISTICS USING RADIO LOGS AND FUZZY SET THEORY

EVALUATING AND ANALYSING DYNAMIC PLAYLIST GENERATION HEURISTICS USING RADIO LOGS AND FUZZY SET THEORY 10th Interntionl Soiety for Musi Informtion Retrievl Conferene (ISMIR 09) EVALATING AND ANALYSING DYNAMIC PLAYLIST GENERATION HERISTICS SING RADIO LOGS AND FZZY SET THEORY Kls Bosteels Ghent niversity,

More information

DYNAMIC ROUTING ALGORITHMS IN VP-BASED ATM NETWORKS

DYNAMIC ROUTING ALGORITHMS IN VP-BASED ATM NETWORKS DYNAMIC ROUTING ALGORITHMS IN VP-BASED ATM NETWORKS Hon-Wi Chu n Dnny H K Tsng Deprtment of Electricl & Electronic Engineering The Hong Kong University of Science & Technology, Cler Wter By, Kowloon, Hong

More information

COMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA:

COMPUTER EDUCATION TECHNIQUES, INC. (WEBLOGIC_SVR_ADM ) SA: In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following

More information

Cellular-based Population to Enhance Genetic Algorithm for Assignment Problems

Cellular-based Population to Enhance Genetic Algorithm for Assignment Problems Amerin Journl of Intelligent Systems. 0; (): -5 DOI: 0. 593/j.jis.000.0 Cellulr-se Popultion to Enhne Geneti Algorithm for Assignment Prolems Hossein Rjlipour Cheshmehgz *, Hiollh Hron, Mohmm Rez Myoi

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

Prefetching in an Intelligent Memory Architecture Using a Helper Thread

Prefetching in an Intelligent Memory Architecture Using a Helper Thread Prefething in n Intelligent Memory Arhiteture Using Helper Thre Yn Solihin, Jejin Lee, n Josep Torrells University of Illinois t Urn-Chmpign Mihign Stte University solihin,torrells @s.uiu.eu jlee@se.msu.eu

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

WORKSHOP 6 FRAME SURFACE MODEL ANALYSIS

WORKSHOP 6 FRAME SURFACE MODEL ANALYSIS WORKSHOP 6 FRAME SURFACE MODEL ANALYSIS WS6-1 WS6-2 Workshop Ojetives Crete finite element moel (meshes; onnet jent elements; pply e los, operting los, n grvity los; onstrin noes) for intermeitely iffiult

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to djcent tht do not overlp shre n rm from the sme vertex point re clled djcent ngles. me the djcent cute ngles in this digrm rm is shred y + + me vertex point for + + + is djcent to + djcent simply mens

More information

Adaptive Pixel Interpolation for Spatial Error Concealment

Adaptive Pixel Interpolation for Spatial Error Concealment J Sign Proess Syst (2010) 60:291 303 DOI 10.1007/s11265-009-0367-y Aptive Pixel Interpoltion for Sptil Error Conelment Li Song & Xin M Reeive: 9 Novemer 2008 / Revise: 23 Mrh 2009 /Aepte: 30 Mrh 2009 /Pulishe

More information

COMPUTER EDUCATION TECHNIQUES, INC. (XML ) SA:

COMPUTER EDUCATION TECHNIQUES, INC. (XML ) SA: In orer to lern whih questions hve een nswere orretly: 1. Print these pges. 2. Answer the questions. 3. Sen this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following

More information

Misrepresentation of Preferences

Misrepresentation of Preferences Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from

More information

Problem Final Exam Set 2 Solutions

Problem Final Exam Set 2 Solutions CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs

Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the

More information

Order these angles from smallest to largest by wri ng 1 to 4 under each one. Put a check next to the right angle.

Order these angles from smallest to largest by wri ng 1 to 4 under each one. Put a check next to the right angle. Lines nd ngles Connect ech set of lines to the correct nme: prllel perpendiculr Order these ngles from smllest to lrgest y wri ng to 4 under ech one. Put check next to the right ngle. Complete this tle

More information

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

Software Configuration Management

Software Configuration Management Softwre Configurtion Mngement Leture: Introdution SCM Chpters: 1, 2 nd 3 René Krikhr Niels Veermn Leture Objetives Lern bout SCM nd history of SCM Lern the reltion between SCM nd Softwre development proess

More information

[SYLWAN., 158(6)]. ISI

[SYLWAN., 158(6)]. ISI The proposl of Improved Inext Isomorphi Grph Algorithm to Detet Design Ptterns Afnn Slem B-Brhem, M. Rizwn Jmeel Qureshi Fulty of Computing nd Informtion Tehnology, King Adulziz University, Jeddh, SAUDI

More information

LETKF compared to 4DVAR for assimilation of surface pressure observations in IFS

LETKF compared to 4DVAR for assimilation of surface pressure observations in IFS LETKF compred to 4DVAR for ssimiltion of surfce pressure oservtions in IFS Pu Escrià, Mssimo Bonvit, Mts Hmrud, Lrs Isksen nd Pul Poli Interntionl Conference on Ensemle Methods in Geophysicl Sciences Toulouse,

More information