ScoreKeeperWEB Youth Game Protocol
|
|
- Ami Williamson
- 6 years ago
- Views:
Transcription
1 SceKeeperWEB th Gme Procol must hve live Internet cnecti sce. power Internet cnecti fils while scing d t pnic, ll dt sred in temp file. Once power / cnecti resred cn log bck in scing where left f. Be hve crect numr fe gin scing. sce t rink pper SceKeeper Wk hve 24 hours stttics in SceKeeperWEB. re re suspendble penlties dt must ed four hours cclusi. Once dt ed in SceKeeperWEB mil sce ddress printed bck sce. Be ffix proper US postge. Quest dficulty ing ny dt infmti; plese ctct Li Tomsello, luck6161@ol.com Lou Glli, lou@njfreeze.com. R1
2 login login r r nme nme psswd psswd provided provided Legue. Legue. Login Login infmti infmti (both (both rnme rnme psswds psswds re re CSe CSe SeNsItIvE SeNsItIvE see see AMH AMH in in blue blue b b re re t t crect crect ddress. ddress. From From ny ny Internet Internet browser browser (Chrome (Chrome Expler, Expler, FireFox, FireFox, NetScpe NetScpe Sfri) Sfri) following following ddress: ddress: (tke (tke e e /login /login t t end end ddress). ddress). Th Th bring bring min min login login screen screen dplyed dplyed here. here. Do Do ny ny infmti infmti thru thru AOL s AOL s integrted integrted browser. browser.
3 To To ccess ccess SceKeeperWEB SceKeeperWEB Gme Gme Mngement Mngement tb tb select select SceKeeperWEB. SceKeeperWEB.
4 Universl Universl Ic Ic Set Set d d throughout throughout progrm. progrm. All All ics ics my my present present f f ll ll funct. funct. Plus Plus Add Add dt dt Pencil Pencil Edit Edit dt dt Trsh Trsh Delete Delete Mgnying Mgnying Glss Glss Serch Serch Dul Dul Arrows Arrows Refresh Refresh numr numr f f wh wh sce. sce. Click Click Lod Lod Gme Gme ic. ic. Note: Note: It It cn cn tke tke minute minute ( ( lger lger depending depending r r Internet Internet speed) speed) lod lod dt. dt. Click Click OK OK
5 The The electric electric sce sce lod. lod. Double Double check check r r.. hve hve clock clock functi functi SceKeeperWEB. SceKeeperWEB. elect elect th th opti opti hve hve ll ll gol gol penlty penlty s s mnully. mnully. Double Double check check tht tht hve hve crect crect loded. loded. By By defult defult ll ll plyers plyers ( ( coches) coches) suspended suspended previous previous highlighted highlighted green green check. check. plyer plyer coch coch prticipting prticipting in in scrtch scrtch plyer plyer coch coch ing ing Check Check Box. Box.
6 Using Using Universl Universl Ic Ic Set Set dd dd both both r r home home vir vir golies golies ing ing + + ic. ic. Golie Golie stts stts umticlly umticlly clculte. clculte. hve hve mnully mnully ny ny sttticl sttticl infmti. infmti. From From roster roster selecti selecti select select golie golie tht tht plying plying Submit. Submit. chnge chnge golies golies hve hve ny ny infmti infmti screen. screen. Only Only exit exit period, period, when when chnge chnge golies. golies.
7 To To dd dd gol, gol, Universl Universl Ic Ic Set Set + + ic. ic. Repet Repet th th sme sme f f dding dding penlties penlties When When ing ing gols gols penlties penlties wll wll clock clock system system cvert cvert umticlly. umticlly. infmti infmti f f gol gol sced. sced. re re SceKeeperWEB SceKeeperWEB clock clock umticlly umticlly ed. ed. Once Once hve hve ed ed necessry necessry infmti infmti pertining pertining gol gol Submit. Submit.
8 To To dd dd Click Click crespding crespding numr numr shot. shot. When When gol gol sced sced DO DO NOT NOT hve hve shot. shot. cn cn lso lso type type tls tls t t period period end end should should wh wh tlly tlly scrp scrp pper. pper.
9 Th Th smple smple ly ly sced sced.. cn cn exp exp collpse collpse dilog dilog boxes boxes need need me me mir mir rel rel estte. estte. cn cn edit edit increct increct entries entries Universl Universl Ics Ics when when present. present. wnt wnt strt strt scing scing ginning ginning blnk blnk sce sce r r cn cn ll ll dt dt ing ing Cler Cler Gme Gme Th Th ll ll infmti infmti ed, ed, hve hve strt strt ginning. ginning.
10 After After Officil's Officil's sce sce re re tht tht stttics stttics re re crect, crect, re re t t rink rink eir eir Scekeeper Scekeeper Officil's Officil's cn cn ir ir nme nme (first (first lst), lst), re re scing scing t t home home SceKeeper SceKeeper Wk Wk dt dt signed signed wk wk Close Close Gme. Gme. Once Once Close Close Gme Gme dt dt seled, seled, no no furr furr chnges chnges cn cn mde. mde. After After must must close-out close-out pri pri closing closing.. required required infmti. infmti. After After Officil's Officil's sce sce re re t t rink rink Officil's Officil's cn cn ir ir nme nme (first (first lst) lst) digitlly digitlly sign sign sce sce..
11 When When re re de de scing scing r r Logout Logout system. system.
style type="text/css".wpb_animate_when_almost_visible { opacity: 1; }/style
style type="text/css".wpb_nimte_when_lmost_vible { opcity: 1; }/style You cn chrome homepge for internet explorer quickly chrome homepge for internet explorer get chrome homepge for internet explorer every
More informationLicense Manager Installation and Setup
The Network License (concurrent-user) version of e-dpp hs hrdwre key plugged to the computer running the License Mnger softwre. In the e-dpp terminology, this computer is clled the License Mnger Server.
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationInstallation Guide AT-VTP-800
Velocity 8 Touch Pnel The Atlon -BL nd -WH re 8 touch pnels in blck nd white, respectively, for the Atlon Velocity Control System. They feture contemporry, refined styling for modern presenttion environments
More informationTEAM PLAYER & COACH MANAGEMENT
TEAM PLAYER & COACH MANAGEMENT Your complete team roster must be entered into the on-line database by the date determined by the League. Your AYHL Roster MUST match your team s USA Hockey Roster, no exceptions.
More informationStart Here. Remove all tape and lift display. Locate components
HP Photosmrt 2600/2700 series ll-in-one User Guide Strt Here 1 USB cle users: Do not connect the USB cle until this guide instructs you to or the softwre my not instll properly. Use this guide to set up
More informationTECHNICAL NOTE MANAGING JUNIPER SRX PCAP DATA. Displaying the PCAP Data Column
TECHNICAL NOTE MANAGING JUNIPER SRX PCAP DATA APRIL 2011 If your STRM Console is configured to integrte with the Juniper JunOS Pltform DSM, STRM cn receive, process, nd store Pcket Cpture (PCAP) dt from
More informationAgilent Mass Hunter Software
Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss
More informationFile Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment
File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationpdfapilot Server 2 Manual
pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:
More informationEpson Projector Content Manager Operation Guide
Epson Projector Content Mnger Opertion Guide Contents 2 Introduction to the Epson Projector Content Mnger Softwre 3 Epson Projector Content Mnger Fetures... 4 Setting Up the Softwre for the First Time
More informationCumulus POS 02/19/2018. User Reference Manual
Cumulus POS Cumulus POS 02/19/2018 User Reference Mnul This mnul, s well s the softwre described in it, is furnished under license nd my only be used or copied in ccordnce with the terms of such license.
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationEasyMP Network Projection Operation Guide
EsyMP Network Projection Opertion Guide Contents 2 Introduction to EsyMP Network Projection EsyMP Network Projection Fetures... 5 Disply Options... 6 Multi-Screen Disply Function... 6 Movie Sending Mode...
More informationMedia Player Using Media Player Downloading Media Files Playing Music Playing Movie Using Playlist...
Using... -2 Downloding Medi Files... -3 Downloding Music & Movies...-3 Sving Medi Files to Phone/Memory Crd...-3 Plying Music... -3 Music Window...-4 Plying Music...-4 Plying Movie... -5 Movie Window...-6
More informationvcloud Director Service Provider Admin Portal Guide vcloud Director 9.1
vcloud Director Service Provider Admin Portl Guide vcloud Director 9. vcloud Director Service Provider Admin Portl Guide You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationNOTES. Figure 1 illustrates typical hardware component connections required when using the JCM ICB Asset Ticket Generator software application.
ICB Asset Ticket Genertor Opertor s Guide Septemer, 2016 Septemer, 2016 NOTES Opertor s Guide ICB Asset Ticket Genertor Softwre Instlltion nd Opertion This document contins informtion for downloding, instlling,
More informationMigrating vrealize Automation to 7.3 or March 2018 vrealize Automation 7.3
Migrting vrelize Automtion to 7.3 or 7.3.1 15 Mrch 2018 vrelize Automtion 7.3 You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/ If you hve comments bout
More informationEasyMP Multi PC Projection Operation Guide
EsyMP Multi PC Projection Opertion Guide Contents 2 About EsyMP Multi PC Projection Meeting Styles Proposed by EsyMP Multi PC Projection... 5 Holding Meetings Using Multiple Imges... 5 Holding Remote Meetings
More informationView, evaluate, and publish assignments using the Assignment dropbox.
Blckord Lerning System CE 6 Mnging Assignments Competencies After reding this document, you will e le to: Crete ssignments using the Assignment tool. View, evlute, nd pulish ssignments using the Assignment
More informationMcAfee Network Security Platform
Mnger Applince Quick Strt Guide Revision B McAfee Network Security Pltform This guide is high-level description of how to instll nd configure the Mnger Applince. For more detiled instlltion informtion,
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationEasyMP Multi PC Projection Operation Guide
EsyMP Multi PC Projection Opertion Guide Contents 2 About EsyMP Multi PC Projection Meeting Styles Proposed by EsyMP Multi PC Projection... 5 Holding Meetings Using Multiple Imges... 5 Holding Remote Meetings
More informationOPERATION MANUAL. DIGIFORCE 9307 PROFINET Integration into TIA Portal
OPERATION MANUAL DIGIFORCE 9307 PROFINET Integrtion into TIA Portl Mnufcturer: 2018 burster präzisionsmesstechnik gmbh & co kg burster präzisionsmesstechnik gmbh & co kg Alle Rechte vorbehlten Tlstrße
More informationAlphabetic Input and Ties (Musical Example: Finlandia by Jean Sibelius)
2 Alphbetic Input nd Ties (Musicl Exmple: Finlndi by Jen Sibelius) 19 Ech chpter in section I will introduce specific set of nottion skills. I thought it would be fun to lern how to use Sibelius by writing
More informationEasyMP Network Projection Operation Guide
EsyMP Network Projection Opertion Guide Contents 2 About EsyMP Network Projection Functions of EsyMP Network Projection... 5 Vrious Screen Trnsfer Functions... 5 Instlling the Softwre... 6 Softwre Requirements...6
More informationAddress/Data Control. Port latch. Multiplexer
4.1 I/O PORT OPERATION As discussed in chpter 1, ll four ports of the 8051 re bi-directionl. Ech port consists of ltch (Specil Function Registers P0, P1, P2, nd P3), n output driver, nd n input buffer.
More informationEasyMP Multi PC Projection Operation Guide
EsyMP Multi PC Projection Opertion Guide Contents 2 Introduction to EsyMP Multi PC Projection 5 EsyMP Multi PC Projection Fetures... 6 Connection to Vrious Devices... 6 Four-Pnel Disply... 6 Chnge Presenters
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationEpson iprojection Operation Guide (Windows/Mac)
Epson iprojection Opertion Guide (Windows/Mc) Contents 2 Introduction to Epson iprojection 5 Epson iprojection Fetures... 6 Connection to Vrious Devices... 6 Four-Pnel Disply... 6 Chnge Presenters nd Projection
More informationLab 1 - Counter. Create a project. Add files to the project. Compile design files. Run simulation. Debug results
1 L 1 - Counter A project is collection mechnism for n HDL design under specifiction or test. Projects in ModelSim ese interction nd re useful for orgnizing files nd specifying simultion settings. The
More informationRegistering as a HPE Reseller. Quick Reference Guide for new Partners in Asia Pacific
Registering s HPE Reseller Quick Reference Guide for new Prtners in Asi Pcific Registering s new Reseller prtner There re five min steps to e new Reseller prtner. Crete your Appliction Copyright 2017 Hewlett
More informationHow. Without. project. your. wanting. personal. Corey. by Galen E
B or How personl Whout wnting! n by Glen E Corey SO 've built cool A show tell Get grndm tweet out World resume THERE! OUT work how? http:// Coolest locl host Se : 3000 file Ever Mybe 're se tl/users1gien1s1colindexhtml
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationLoad the ribbon on the ribbon cartridge. Load the ribbon cartridge in the printer. Fan the cards, and then load them in the input hopper.
Open the printer cover. Slide the clening roller onto the clening sleeve (). Remove the protective wrp from the clening roller () nd instll the clening roller in the printer (c). Lod the rion on the rion
More informationDeposit a Technical Report in PubRep
Technicl in Lst Updte:19.12.016 Te c h n i c l Technicl s re mjor source of scientific informtion, prepred for institutionl nd wider distribution. They re considered grey literture since they re scientific
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationc360 Add-On Solutions
c360 Add-On Solutions Functionlity Dynmics CRM 2011 c360 Record Editor Reltionship Explorer Multi-Field Serch Alerts Console c360 Core Productivity Pck "Does your tem resist using CRM becuse updting dt
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationGeorge Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
More informationSage CRM 2018 R1 Software Requirements and Mobile Features. Updated: May 2018
Sge CRM 2018 R1 Softwre Requirements nd Mobile Fetures Updted: My 2018 2018, The Sge Group plc or its licensors. Sge, Sge logos, nd Sge product nd service nmes mentioned herein re the trdemrks of The Sge
More informationLCI/USB LonWorks Commissioning Interface
Works Commissioning Interfce Importnt: Retin these instructions CONTENTS 1 Unpcking... 1 2 Storing... 1 3 Instlltion... 1 4 Uninstlling the USB Drivers... 8 5 Disposl... 8 1 UNPACKING Instlltion Instructions
More informationRegistering as an HPE Reseller
Registering s n HPE Reseller Quick Reference Guide for new Prtners Mrch 2019 Registering s new Reseller prtner There re four min steps to register on the Prtner Redy Portl s new Reseller prtner: Appliction
More informationSage CRM 2017 R3 Software Requirements and Mobile Features. Updated: August 2017
Sge CRM 2017 R3 Softwre Requirements nd Mobile Fetures Updted: August 2017 2017, The Sge Group plc or its licensors. Sge, Sge logos, nd Sge product nd service nmes mentioned herein re the trdemrks of The
More informationIST 220: Ch3-Transport Layer
ST 220: Ch3-Trns Lyer Abdullh Konk School of nformtion Sciences nd Technology Penn Stte Berks Lerning Objectives. Understnd position of trns lyer in nternet model. Understnd rtionle for extence of trns
More informationSpring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.
15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge
More informationEasy Interactive Tools Ver.3.0 Operation Guide
Esy Interctive Tools Ver.3.0 Opertion Guide Esy Interctive Tools Summry 2 Fetures Esy Interctive Tools is n ppliction tht llows you to drw on projected imges. By using the interctive pen supplied with
More informationOnline Portal Guide. Access your policy information, documentation, claim forms and claims history easily and securely.
Online Portl Guide Access your policy informtion, documenttion, clim forms nd clims history esily nd securely. version dte: 12/2017 YOUR ONLINE PORTAL ACCESS URL & REGIONAL CONTACTS HONG KONG SINGAPORE
More informationSage CRM 2017 R2 Software Requirements and Mobile Features. Revision: IMP-MAT-ENG-2017R2-2.0 Updated: August 2017
Sge CRM 2017 R2 Softwre Requirements nd Mobile Fetures Revision: IMP-MAT-ENG-2017R2-2.0 Updted: August 2017 2017, The Sge Group plc or its licensors. Sge, Sge logos, nd Sge product nd service nmes mentioned
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-188 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationCOMPUTER EDUCATION TECHNIQUES, INC. (MS_W2K3_SERVER ) SA:
In order to lern which questions hve een nswered correctly: 1. Print these pges. 2. Answer the questions. 3. Send this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following
More informationMcAfee Network Security Platform
NTBA Applince T-200 nd T-500 Quick Strt Guide Revision B McAfee Network Security Pltform 1 Instll the mounting rils Position the mounting rils correctly nd instll them t sme levels. At the front of the
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationTixeo compared to other videoconferencing solutions
compred to other videoconferencing solutions for V171026EN , unique solution on the video conferencing field Adobe Connect Web RTC Vydio for High security level, privcy Zero impct on network security policies
More informationVMware Horizon JMP Server Installation and Setup Guide. Modified on 06 SEP 2018 VMware Horizon 7 7.6
VMwre Horizon JMP Server Instlltion nd Setup Guide Modified on 06 SEP 2018 VMwre Horizon 7 7.6 You cn find the most up-to-dte technicl documenttion on the VMwre wesite t: https://docs.vmwre.com/ If you
More informationUpgrading from vrealize Automation 7.1 or Later to June 2018 vrealize Automation 7.4
Upgrding from vrelize Automtion 7.1 or Lter to 7.4 15 June 2018 vrelize Automtion 7.4 You cn find the most up-to-dte technicl documenttion on the VMwre wesite t: https://docs.vmwre.com/ If you hve comments
More informationScenarios. VMware Validated Design for IT Automating IT 4.0 EN
Scenrios VMwre Vlidted Design for IT Automting IT 4.0 This document supports the version of ech product listed nd supports ll susequent versions until the document is replced y new edition. To check for
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationEnterprise Digital Signage Create a New Sign
Enterprise Digitl Signge Crete New Sign Intended Audiene: Content dministrtors of Enterprise Digitl Signge inluding stff with remote ess to sign.pitt.edu nd the Content Mnger softwre pplition for their
More informationPhysics 208: Electricity and Magnetism Exam 1, Secs Feb IMPORTANT. Read these directions carefully:
Physics 208: Electricity nd Mgnetism Exm 1, Secs. 506 510 11 Feb. 2004 Instructor: Dr. George R. Welch, 415 Engineering-Physics, 845-7737 Print your nme netly: Lst nme: First nme: Sign your nme: Plese
More informationInformation regarding
Informtion regrding LANCOM Advnced VPN Client 3.13 Copyright (c) 2002-2017 LANCOM Systems GmbH, Wuerselen (Germny) LANCOM Systems GmbH does not tke ny gurntee nd libility for softwre not developed, mnufctured
More informationSoftware Release Note
Softwre Relese Note Softwre Nme: DSU Version No. Build Code Supported OS Apply to (full model nme) New Feture(s) Chnge(s) Enhncement(s) Bug(s) Fixed Additionl Note(s) 2.2 Build 17051810 2003 NPort M12
More informationPackage Contents. Wireless-G USB Network Adapter with SpeedBooster USB Cable Setup CD-ROM with User Guide (English only) Quick Installation
A Division of Ciso Systems, In. Pkge Contents Wireless-G USB Network Adpter with SpeedBooster USB Cle Setup CD-ROM with User Guide (English only) Quik Instlltion 2,4 GHz 802.11g Wireless Model No. Model
More informationVery sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.
6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!
More informationFall 2018 Midterm 2 November 15, 2018
Nme: 15-112 Fll 2018 Midterm 2 November 15, 2018 Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationTo access your mailbox from inside your organization. For assistance, call:
2001 Ative Voie, In. All rights reserved. First edition 2001. Proteted y one or more of the following United Sttes ptents:,070,2;,3,90;,88,0;,33,102;,8,0;,81,0;,2,7;,1,0;,90,88;,01,11. Additionl U.S. nd
More informationUpgrading from vrealize Automation 7.1, 7.2 to 7.3 or 7.1, 7.2, 7.3 to March 2018 vrealize Automation 7.3
Upgrding from vrelize Automtion 7.1, 7.2 to 7.3 or 7.1, 7.2, 7.3 to 7.3.1 15 Mrch 2018 vrelize Automtion 7.3 You cn find the most up-to-dte technicl documenttion on the VMwre wesite t: https://docs.vmwre.com/
More informationWelch Allyn CardioPerfect Workstation Installation Guide
Welch Allyn CrdioPerfect Worksttion Instlltion Guide INSTALLING CARDIOPERFECT WORKSTATION SOFTWARE & ACCESSORIES ON A SINGLE PC For softwre version 1.6.6 or lter For network instlltion, plese refer to
More informationMATH 2530: WORKSHEET 7. x 2 y dz dy dx =
MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More informationFall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.
15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for
More informationDVD-SL25 INSTRUCTION MANUAL. DVD Player 1AD6P1P1806-A (CA) English PAUSE/STEP PLAY SURROUND ON SCREEN ENT CLEAR PICTURE PROGRAM /RANDOM ANGLE REPLAY
INSTRUCTION MANUAL DVD-SL2 DVD Plyer A-B RE AUDIO TOP 6 0 7 8 9 SEARCH f e n q z/on REMOTE CONTROLLER RB-SL2 TM TM 1AD6P1P1806-A (CA) English AUDIO TOP REMOTE CONTROLLER RB-SL2 A-B RE SEARCH CONTS Accessories...
More informationMidterm I Solutions CS164, Spring 2006
Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,
More informationIt consists of two cold rooms, each with their own evaporator but sharing the same cooling flui d R134a system ( compressor, condenser...).
This system llows study of refrigertion systems implementtion of rmodyn mic clcultions pplied to refrigertion Its uniqueness is tht it is fully controllble vi Internet directly from web browser like Internet
More informationDigital Design. Chapter 1: Introduction. Digital Design. Copyright 2006 Frank Vahid
Chpter : Introduction Copyright 6 Why Study?. Look under the hood of computers Solid understnding --> confidence, insight, even better progrmmer when wre of hrdwre resource issues Electronic devices becoming
More informationCompatibility Testing - A Must Do of the Web Apps. By Premalatha Shanmugham & Kokila Elumalai
Comptibility Testing - A Must Do of the Web Apps By Premlth Shnmughm & Kokil Elumli Agend The Need The Impct The Chllenges The Strtegy The Checklist Metrics Inferences The Rod Ahed 2 2012 Indium Softwre
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationScenarios. VMware Validated Design 4.0 VMware Validated Design for IT Automating IT 4.0
Scenrios VMwre Vlidted Design 4.0 VMwre Vlidted Design for IT Automting IT 4.0 Scenrios You cn find the most up-to-dte technicl documenttion on the VMwre wesite t: https://docs.vmwre.com/ If you hve comments
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationToday s Lecture. Basics of Logic Design: Boolean Algebra, Logic Gates. Recursive Example. Review: The C / C++ code. Recursive Example (Continued)
Tod s Lecture Bsics of Logic Design: Boolen Alger, Logic Gtes Alvin R. Leeck CPS 4 Lecture 8 Homework #2 Due Ferur 3 Outline Review (sseml recursion) Building the uilding locks Logic Design Truth tles,
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationHP Unified Functional Testing
HP Unified Functionl Testing Softwre Version: 11.50 Enter the operting system(s), e.g. Windows Tutoril for GUI Testing Document Relese Dte: Decemer 2012 Softwre Relese Dte: Decemer 2012 Legl Notices Wrrnty
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationRadiation & Matter 3: Refraction
Rdition & Mtter 3: Refrction Refrction AIM The effects of refrction (the chnge of direction tht tkes plce when light psses fro ir into glss) y hve been et during n erlier study of Physics. The i of this
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationGuide for sending an Electronic Dental referral
Guide for sending n Electronic Dentl referrl 1. Lunch Rego vi your Ptient Record System Open the Rego referrl templte vi your Ptient Record System: Exct / SOE: Open the ptient record, then click on Ptient
More informationRelease Notes for. LANCOM Advanced VPN Client 4.10 Rel
Relese Notes for LANCOM Advnced VPN Client 4.10 Rel Copyright (c) 2002-2018 LANCOM Systems GmbH, Wuerselen (Germny) LANCOM Systems GmbH does not tke ny gurntee nd libility for softwre not developed, mnufctured
More informationCOMPUTATIONAL INTELLIGENCE
COMPUTATIONAL INTELLIGENCE LABORATORY CLASSES Immentton smplstc verson of the network for some nference resons Adrn Horzyk IMPLEMENTATION OF THE SIMPLISTIC OR AANG Imment the smplstc verson of n structure
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More information